View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2371_low_31 (Length: 393)
Name: NF2371_low_31
Description: NF2371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2371_low_31 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 368; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 368; E-Value: 0
Query Start/End: Original strand, 10 - 393
Target Start/End: Original strand, 41277541 - 41277924
Alignment:
| Q |
10 |
aagaatatatggattttaagaaactttagaaataaaaaatgagcttgattgattaattcgggtgtgtctggtatcttttaattttgtgcaggttagagca |
109 |
Q |
| |
|
||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41277541 |
aagaaaatatggattttaagaaacttaagaaataaaaaatgagcttgattgattaattcaggtgtgtctggtatcttttaattttgtgcaggttagagca |
41277640 |
T |
 |
| Q |
110 |
gagatccgaagagctaagattgagttatcatttcagcttcagaggtcaccaacggaggaagaaataatagaaaaagttcatgtatcccctgaaagatacc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41277641 |
gagatccgaagagctaagattgagttatcatttcagcttcagaggtcaccaacggaggaagaaataatagaaaaagttcatgtatcccctgaaagatacc |
41277740 |
T |
 |
| Q |
210 |
gtgatgtaatgaaggcatcaaaaccccttctttcactgcattcaagacatctaaccacgcaagaagagtttatcaatggggtcgttgatgatggtggtgt |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41277741 |
gtgatgtaatgaaggcatcaaaaccccttctttcactgcattcaagacatctaaccacgcaagaagagtttatcaatggggtcgttgatgatggtggtgt |
41277840 |
T |
 |
| Q |
310 |
tgatggcgataacaggaggcaacctgctccactaaggcttgctcttgatgatgtggtaatggctctaaccttttatgtctctgt |
393 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41277841 |
tgatggcgataacaggaggcaacctgctctactaaggcttgctcttgatgatgtggtaatggctctaaccttttatgtctctgt |
41277924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University