View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2371_low_39 (Length: 365)
Name: NF2371_low_39
Description: NF2371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2371_low_39 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 290; Significance: 1e-163; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 1 - 345
Target Start/End: Original strand, 13148333 - 13148678
Alignment:
| Q |
1 |
gttggaatcaaaactgtgtgaaactgactgtataaatatgaaacgatagatcacatttatatggctgagatttcatactgcgtgaaaactgcatggagct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
13148333 |
gttggaatcaaaactgtgtgaaactgactgtataaatataaaacgttagatcacatttatgtggccgagatttcatactgcgtgaaaactgcatggagct |
13148432 |
T |
|
| Q |
101 |
gttacaacatgcactctaggttcgtgtgtgagagatagggagagagagttttgctctcaagtgctacaaagaattatggtttggcataaatattgctttg |
200 |
Q |
| |
|
|| |||||||||| || |||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13148433 |
gtaacaacatgcaatccaggtccgtgtgtgagagatagggagagagagttttgctctcaagtcctacaaagaattatggtttggcataaatattgctttg |
13148532 |
T |
|
| Q |
201 |
gtctctcaagttttataattgtgtgattttggtcacttaagtttcaattgctata-tttaaccctcaaatttatcgtattttgtacttggtagtccttgc |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
13148533 |
gtctctcaagttttataattgtgtgattttggtcccttaagtttcaattgctatattttaaccctcaaatttatcctattttgtacttggtagtccttgc |
13148632 |
T |
|
| Q |
300 |
atattttgactaaaaatcggtcacatgactaattttaatgaagtgg |
345 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13148633 |
atattttgactaaaaatcggtcacatgactaattttaatgatgtgg |
13148678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 7 - 79
Target Start/End: Original strand, 13411196 - 13411268
Alignment:
| Q |
7 |
atcaaaactgtgtgaaactgactgtataaatatgaaacgatagatcacatttatatggctgagatttcatact |
79 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||| || |||||| ||||| |||| | |||||| |||||| |
|
|
| T |
13411196 |
atcaaaactgtgtgaaactaactgtataaatctgaaccgttagatcgcatttttatgaccgagattgcatact |
13411268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 10 - 72
Target Start/End: Original strand, 40160518 - 40160580
Alignment:
| Q |
10 |
aaaactgtgtgaaactgactgtataaatatgaaacgatagatcacatttatatggctgagatt |
72 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||| || |||||| ||||| ||||||||||| |
|
|
| T |
40160518 |
aaaattgtgtgaaactgactgtatcaatatgaaccgttagatcgtatttaagtggctgagatt |
40160580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University