View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2371_low_49 (Length: 323)
Name: NF2371_low_49
Description: NF2371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2371_low_49 |
 |  |
|
| [»] chr6 (39 HSPs) |
 |  |
|
| [»] chr5 (54 HSPs) |
 |  |
|
| [»] chr4 (57 HSPs) |
 |  |
|
| [»] chr3 (67 HSPs) |
 |  |
|
| [»] chr2 (48 HSPs) |
 |  |
|
| [»] scaffold0088 (1 HSPs) |
 |  |
|
| [»] scaffold0275 (1 HSPs) |
 |  |  |
|
| [»] chr7 (41 HSPs) |
 |  |
|
| [»] scaffold0707 (1 HSPs) |
 |  |
|
| [»] scaffold0608 (1 HSPs) |
 |  |
|
| [»] scaffold0445 (1 HSPs) |
 |  |
|
| [»] scaffold0128 (1 HSPs) |
 |  |
|
| [»] scaffold0121 (1 HSPs) |
 |  |
|
| [»] scaffold0100 (1 HSPs) |
 |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |
|
| [»] scaffold0010 (1 HSPs) |
 |  |
|
| [»] scaffold0009 (1 HSPs) |
 |  |
|
| [»] scaffold0006 (1 HSPs) |
 |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |
|
| [»] scaffold0460 (1 HSPs) |
 |  |
|
| [»] scaffold0366 (1 HSPs) |
 |  |
|
| [»] scaffold0014 (1 HSPs) |
 |  |
|
| [»] scaffold1185 (1 HSPs) |
 |  |
|
| [»] scaffold0028 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 91; Significance: 4e-44; HSPs: 65)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 175 - 277
Target Start/End: Complemental strand, 19259532 - 19259430
Alignment:
| Q |
175 |
gcgggagtacttccccactccctaccccaccactaaaattgttctccatccccattttctaccttcgagagtttttcatatccgtctgcatcgtcacaga |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
19259532 |
gcgggagtacttccccactccctaccccaccactaaaattgttctccatccccatttcctaccttcgagagtttttcacgtccgtctgcatcgtcacaga |
19259433 |
T |
 |
| Q |
275 |
tcc |
277 |
Q |
| |
|
||| |
|
|
| T |
19259432 |
tcc |
19259430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 281 - 323
Target Start/End: Complemental strand, 10664869 - 10664827
Alignment:
| Q |
281 |
taatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
10664869 |
taatccccgtgagcttagctcagttggtagggatattgcatat |
10664827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 277 - 323
Target Start/End: Complemental strand, 13538525 - 13538479
Alignment:
| Q |
277 |
ctcttaatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||| |||||||||||| |
|
|
| T |
13538525 |
ctcttaatcccagtgaacttagttcagttggtagggatattgcatat |
13538479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 281 - 323
Target Start/End: Original strand, 18533996 - 18534038
Alignment:
| Q |
281 |
taatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
18533996 |
taatctccgtgagcttagctcagttggtagagatattgcatat |
18534038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 281 - 323
Target Start/End: Original strand, 32594246 - 32594288
Alignment:
| Q |
281 |
taatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
32594246 |
taatccccgtgagcttagctcagttggtagggatattgcatat |
32594288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 281 - 323
Target Start/End: Original strand, 33207200 - 33207242
Alignment:
| Q |
281 |
taatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
33207200 |
taatccccgtgagcttagctcagttggtagggatattgcatat |
33207242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 282 - 323
Target Start/End: Original strand, 21265652 - 21265693
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
21265652 |
aatccccgtgagcttagctcagttggtagggatattgcatat |
21265693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 282 - 323
Target Start/End: Original strand, 42054329 - 42054370
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
42054329 |
aatccccgtgagcttagctcagttggtagggatattgcatat |
42054370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 1151756 - 1151796
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
1151756 |
atccccgtgagcttagctcagttggtagggatattgcatat |
1151796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 1570265 - 1570225
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
1570265 |
atccccgtgagcttagctcagttggtagggatattgcatat |
1570225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 2352638 - 2352598
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
2352638 |
atccccgtgagcttagctcagttgatagagatattgcatat |
2352598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 3269616 - 3269656
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
3269616 |
atccccgtgagcttagctcagttggtagggatattgcatat |
3269656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 4482671 - 4482631
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
4482671 |
atccccgtgagcttagctcagttggtagggatattgcatat |
4482631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 6438137 - 6438097
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
6438137 |
atccccgtgagcttagctcagttggtagggatattgcatat |
6438097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 6702573 - 6702613
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
6702573 |
atccccgtgagcttagctcagttggtagggatattgcatat |
6702613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 7166300 - 7166260
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
7166300 |
atccccgtgagcttagctcagttggtagggatattgcatat |
7166260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 8865851 - 8865891
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
8865851 |
atccccgtgagcttagctcagttggtagggatattgcatat |
8865891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 15819674 - 15819634
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
15819674 |
atccccgtgagcttagctcagttggtagggatattgcatat |
15819634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 22563383 - 22563423
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
22563383 |
atccccgtgagcttagctcagttggtagggatattgcatat |
22563423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 25999847 - 25999887
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
25999847 |
atccccgtgagcttagctcagttggtagggatattgcatat |
25999887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 26584819 - 26584779
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
26584819 |
atccccgtgagcttagctcagttggtagggatattgcatat |
26584779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 33254725 - 33254765
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
33254725 |
atccccgtgagcttagctcagttggtagggatattgcatat |
33254765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 33274897 - 33274937
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
33274897 |
atccccgtgagcttagctcagttggtagggatattgcatat |
33274937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 35605696 - 35605656
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
35605696 |
atccccgtgagcttagctcagttggtagggatattgcatat |
35605656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 40519617 - 40519577
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
40519617 |
atccccgtgagcttagctcagttggtagggatattgcatat |
40519577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 42490483 - 42490443
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
42490483 |
atccccgtgagcttagctcagttggtagggatattgcatat |
42490443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 46965737 - 46965777
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
46965737 |
atccccgtgagcttagctcagttggtagggatattgcatat |
46965777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 50899583 - 50899543
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
50899583 |
atccccgtgagcttagctcagttggtagggatattgcatat |
50899543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 280 - 323
Target Start/End: Original strand, 40520824 - 40520867
Alignment:
| Q |
280 |
ttaatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
40520824 |
ttaatccccgtgagtttagctcagttggtagggatattgcatat |
40520867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 288 - 323
Target Start/End: Complemental strand, 42299581 - 42299546
Alignment:
| Q |
288 |
cgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |
|
|
| T |
42299581 |
cgtgagcttagttcagttggtagggatattgcatat |
42299546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 283 - 321
Target Start/End: Complemental strand, 6893310 - 6893272
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcat |
321 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
6893310 |
atccccgtgagcttagctcagttggtagggatattgcat |
6893272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 285 - 323
Target Start/End: Original strand, 16343027 - 16343065
Alignment:
| Q |
285 |
ccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
16343027 |
ccccgtgagcttagctcagttggtagggatattgcatat |
16343065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 281 - 323
Target Start/End: Original strand, 33033121 - 33033163
Alignment:
| Q |
281 |
taatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||| ||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
33033121 |
taatcaccgtgagcttaattcagttggtagggatattgcatat |
33033163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 281 - 323
Target Start/End: Complemental strand, 37662632 - 37662590
Alignment:
| Q |
281 |
taatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||| ||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
37662632 |
taatcctcgtgagcttagctcagttggtagggatattgcatat |
37662590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 281 - 323
Target Start/End: Original strand, 45271761 - 45271803
Alignment:
| Q |
281 |
taatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||| | ||||||||||||||||| |||||||||||| |
|
|
| T |
45271761 |
taatccccgttaacttagttcagttggtagggatattgcatat |
45271803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 281 - 323
Target Start/End: Complemental strand, 45333786 - 45333744
Alignment:
| Q |
281 |
taatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||||| |||||||| || |||||||||||| |
|
|
| T |
45333786 |
taatccccgtgagcttagctcagttggcagggatattgcatat |
45333744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 287 - 321
Target Start/End: Complemental strand, 45517337 - 45517303
Alignment:
| Q |
287 |
ccgtgagcttagttcagttggtagagatattgcat |
321 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
45517337 |
ccgtgagcttagttcagttggtagggatattgcat |
45517303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 283 - 321
Target Start/End: Original strand, 48638529 - 48638567
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcat |
321 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
48638529 |
atccccgtgagcttagctcagttggtagggatattgcat |
48638567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 282 - 323
Target Start/End: Original strand, 1836499 - 1836540
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||| ||||| |
|
|
| T |
1836499 |
aatccccgtgagcttagctcagttggtagggatattacatat |
1836540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 286 - 323
Target Start/End: Complemental strand, 9866254 - 9866217
Alignment:
| Q |
286 |
cccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
9866254 |
cccgtgagcttagctcagttggtagggatattgcatat |
9866217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 282 - 323
Target Start/End: Complemental strand, 16526251 - 16526210
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||||| ||| ||||||| |||||||||||| |
|
|
| T |
16526251 |
aatccccgtgagcttagctcaattggtagggatattgcatat |
16526210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 282 - 323
Target Start/End: Original strand, 27650693 - 27650734
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||| |||||||| |||||||||||||| |||||||||||| |
|
|
| T |
27650693 |
aatcctcgtgagctaagttcagttggtagggatattgcatat |
27650734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 282 - 323
Target Start/End: Original strand, 34058210 - 34058251
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||| |||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
34058210 |
aatctccgtgagcttagctcagttggtagggatattgcatat |
34058251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 282 - 323
Target Start/End: Complemental strand, 43668031 - 43667990
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||| ||||||| |||||| ||||||||||||||||| |
|
|
| T |
43668031 |
aatccccgtaagcttagctcagttcgtagagatattgcatat |
43667990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 282 - 323
Target Start/End: Original strand, 51050186 - 51050227
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||| |||| |
|
|
| T |
51050186 |
aatccccgtgagcttagctcagttggtagggatattgtatat |
51050227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 287 - 323
Target Start/End: Original strand, 2277755 - 2277791
Alignment:
| Q |
287 |
ccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
2277755 |
ccgtgagcttagctcagttggtagggatattgcatat |
2277791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 2556553 - 2556593
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||| ||||||| ||||||||||| |||||||||||| |
|
|
| T |
2556553 |
atccccgtaagcttagctcagttggtagggatattgcatat |
2556593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 2754357 - 2754397
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
2754357 |
atccccgtgagcttagcttagttggtagggatattgcatat |
2754397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 4553619 - 4553579
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
4553619 |
atccccgtgagcttaactcagttggtagaaatattgcatat |
4553579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 6130106 - 6130066
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||| ||| ||||||||||| |||||||||||| |
|
|
| T |
6130106 |
atccccgtgagcgtagctcagttggtagggatattgcatat |
6130066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 11065117 - 11065157
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||| |
|
|
| T |
11065117 |
atccccgtgagcttagctcagatgatagagatattgcatat |
11065157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 287 - 323
Target Start/End: Original strand, 11215002 - 11215038
Alignment:
| Q |
287 |
ccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
11215002 |
ccgtgagcttagctcagttggtagggatattgcatat |
11215038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 13773165 - 13773205
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
13773165 |
atccccgtgagtttagctcagttggtagggatattgcatat |
13773205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 287 - 323
Target Start/End: Original strand, 16182199 - 16182235
Alignment:
| Q |
287 |
ccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||| |
|
|
| T |
16182199 |
ccgtgagcttagctgagttggtagagatattgcatat |
16182235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 18216903 - 18216943
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||| ||||| |
|
|
| T |
18216903 |
atccccgtgagcttagctcagttggtagggatattacatat |
18216943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 18467271 - 18467231
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||| ||| ||||||||||| |||||||||||| |
|
|
| T |
18467271 |
atccccgtgagcatagctcagttggtagggatattgcatat |
18467231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 18551706 - 18551666
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
18551706 |
atccccgtgagcttagctcagttggtatggatattgcatat |
18551666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 286 - 322
Target Start/End: Original strand, 24874971 - 24875007
Alignment:
| Q |
286 |
cccgtgagcttagttcagttggtagagatattgcata |
322 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
24874971 |
cccgtgagcttagctcagttggtagggatattgcata |
24875007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 287 - 323
Target Start/End: Original strand, 25580689 - 25580725
Alignment:
| Q |
287 |
ccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25580689 |
ccgtgagcttaactcagttggtagagatattgcatat |
25580725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 27344476 - 27344516
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||| ||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
27344476 |
atcctcgtgagcttagctcagttggtagacatattgcatat |
27344516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 40375388 - 40375348
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||| ||| ||||||||||| |||||||||||| |
|
|
| T |
40375388 |
atccccgtgagcatagctcagttggtagggatattgcatat |
40375348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 43884791 - 43884831
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
43884791 |
atccccgtgagtttagctcagttggtagggatattgcatat |
43884831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 44732630 - 44732670
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
44732630 |
atccccgtgagcttaactcagttggtagggatattgcatat |
44732670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 47402736 - 47402696
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| |||| |||||| |||||||||||| |
|
|
| T |
47402736 |
atccccgtgagcttagctcagctggtagggatattgcatat |
47402696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 287 - 323
Target Start/End: Original strand, 48643625 - 48643661
Alignment:
| Q |
287 |
ccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||| |
|
|
| T |
48643625 |
ccgtgagcttagtttagctggtagagatattgcatat |
48643661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 38; Significance: 0.000000000002; HSPs: 39)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 282 - 323
Target Start/End: Complemental strand, 19892350 - 19892309
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
19892350 |
aatccccgtgagcttagttcagttggtagggatattgcatat |
19892309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 280 - 321
Target Start/End: Original strand, 30704954 - 30704995
Alignment:
| Q |
280 |
ttaatccccgtgagcttagttcagttggtagagatattgcat |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
30704954 |
ttaatccccgtgagcttagttcagttggtagggatattgcat |
30704995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 282 - 323
Target Start/End: Original strand, 4408354 - 4408395
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
4408354 |
aatccccgtgagcttagctcagttggtagggatattgcatat |
4408395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 282 - 323
Target Start/End: Complemental strand, 17441913 - 17441872
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
17441913 |
aatccccgtgagcttagctcagttggtagggatattgcatat |
17441872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 282 - 323
Target Start/End: Complemental strand, 19953902 - 19953861
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
19953902 |
aatccccgtgagcttagctcagttggtagggatattgcatat |
19953861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 286 - 323
Target Start/End: Complemental strand, 34432867 - 34432830
Alignment:
| Q |
286 |
cccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34432867 |
cccgtgagcttagttcagttggtagggatattgcatat |
34432830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 607184 - 607224
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
607184 |
atccccgtgagcttagctcagttggtagggatattgcatat |
607224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 3794246 - 3794206
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
3794246 |
atccccgtgagcttagctcagttggtagggatattgcatat |
3794206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 7207841 - 7207881
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
7207841 |
atccccgtgagcttagctcagttggtagggatattgcatat |
7207881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 7545326 - 7545366
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
7545326 |
atccccgtgagcttagctcagttggtagggatattgcatat |
7545366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 7865428 - 7865388
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
7865428 |
atccccgtgagcttagctcagttggtagggatattgcatat |
7865388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 9246455 - 9246415
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
9246455 |
atccccgtgagcttagctcagttggtagggatattgcatat |
9246415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 9372274 - 9372234
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
9372274 |
atccccgtgagcttagctcagttggtagggatattgcatat |
9372234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 9435623 - 9435663
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
9435623 |
atccccgtgagcttagctcagttggtagggatattgcatat |
9435663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 10934596 - 10934636
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
10934596 |
atccccgtgagcttagctcagttggtagggatattgcatat |
10934636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 15091445 - 15091485
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
15091445 |
atccccgtgagcttagctcagttggtagggatattgcatat |
15091485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 17454818 - 17454778
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
17454818 |
atccccgtgagcttatctcagttggtagagatattgcatat |
17454778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 30885643 - 30885603
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
30885643 |
atccccgtgagcttagctcagttggtagggatattgcatat |
30885603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 32813723 - 32813683
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
32813723 |
atccccgtgagcttagttcagttggtacggatattgcatat |
32813683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 33573814 - 33573854
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
33573814 |
atccccgtgagcttagctcagttggtagggatattgcatat |
33573854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 284 - 318
Target Start/End: Original strand, 16406567 - 16406601
Alignment:
| Q |
284 |
tccccgtgagcttagttcagttggtagagatattg |
318 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |
|
|
| T |
16406567 |
tccccgtgagcttagttcaattggtagagatattg |
16406601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 279 - 321
Target Start/End: Original strand, 31705892 - 31705934
Alignment:
| Q |
279 |
cttaatccccgtgagcttagttcagttggtagagatattgcat |
321 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
31705892 |
cttaatccccgtgagcttagctcagttggtatggatattgcat |
31705934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 285 - 322
Target Start/End: Original strand, 2251837 - 2251874
Alignment:
| Q |
285 |
ccccgtgagcttagttcagttggtagagatattgcata |
322 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
2251837 |
ccccgtgagcttagctcagttggtagggatattgcata |
2251874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 286 - 323
Target Start/End: Original strand, 8439675 - 8439712
Alignment:
| Q |
286 |
cccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
8439675 |
cccgtgagcttagctcagttggtagggatattgcatat |
8439712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 282 - 323
Target Start/End: Original strand, 8857086 - 8857127
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||| ||||| |
|
|
| T |
8857086 |
aatccccgtgagcttagctcagttggtagggatattacatat |
8857127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 290 - 323
Target Start/End: Complemental strand, 14709086 - 14709053
Alignment:
| Q |
290 |
tgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
14709086 |
tgagcctagttcagttggtagagatattgcatat |
14709053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 1968993 - 1969033
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||| ||||| |
|
|
| T |
1968993 |
atccccgtgagcttagctcagttggtagggatattacatat |
1969033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 287 - 323
Target Start/End: Original strand, 3294765 - 3294801
Alignment:
| Q |
287 |
ccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
3294765 |
ccgtgagcttagctcagttggtagggatattgcatat |
3294801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 282 - 322
Target Start/End: Original strand, 3640510 - 3640550
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcata |
322 |
Q |
| |
|
||||| ||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
3640510 |
aatcctcgtgagcttagctcagttggtagggatattgcata |
3640550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 4661093 - 4661133
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
4661093 |
atccccgtgagcttagcttagttggtagggatattgcatat |
4661133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 6210051 - 6210091
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||| ||||| ||||||||||| |||||||||||| |
|
|
| T |
6210051 |
atccccgtgaacttagctcagttggtagggatattgcatat |
6210091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 6419155 - 6419115
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
6419155 |
atccccgtgagtttaactcagttggtagagatattgcatat |
6419115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 9704414 - 9704454
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||| ||||| ||||||||||| |||||||||||| |
|
|
| T |
9704414 |
atccccgtgaacttagctcagttggtagggatattgcatat |
9704454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 13732809 - 13732849
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
13732809 |
atccccgtgagcttaactcagttggtagggatattgcatat |
13732849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 27094880 - 27094840
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
27094880 |
atccccgtgagcttaactcagttggtagggatattgcatat |
27094840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 28030861 - 28030901
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||| |||||||||| ||||||||||| |||||||||||| |
|
|
| T |
28030861 |
atccctgtgagcttagctcagttggtagggatattgcatat |
28030901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 29284263 - 29284303
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
29284263 |
atccccgtgagtttagctcagttggtagggatattgcatat |
29284303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 31104879 - 31104919
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||| ||||| |
|
|
| T |
31104879 |
atccccgtgagcttagttcagttgatagggatattacatat |
31104919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 31802050 - 31802090
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
31802050 |
atccccgtgagcttaactcagttggtagggatattgcatat |
31802090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 38; Significance: 0.000000000002; HSPs: 54)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 282 - 323
Target Start/End: Original strand, 35241392 - 35241433
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35241392 |
aatctccgtgagcttagttcagttggtagagatattgcatat |
35241433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 12767961 - 12768001
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
12767961 |
atccccgtgagcttagttcagttggtagggatattgcatat |
12768001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 36888468 - 36888428
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
36888468 |
atccccgtgagcttagttcagttggtagggatattgcatat |
36888428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 1269240 - 1269200
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
1269240 |
atccccgtgagcttagctcaattggtagagatattgcatat |
1269200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 1743124 - 1743164
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
1743124 |
atccccgtgagcttagctcagttggtagggatattgcatat |
1743164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 4417758 - 4417718
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
4417758 |
atccccgtgagcttagctcagttggtagggatattgcatat |
4417718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 6518849 - 6518809
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
6518849 |
atccccgtgagcttagctcagttggtagggatattgcatat |
6518809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 8478966 - 8478926
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
8478966 |
atccccgtgagtttagttcagttggtagggatattgcatat |
8478926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 9125660 - 9125700
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
9125660 |
atccccgtgagcttagctcagttggtagcgatattgcatat |
9125700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 9835030 - 9835070
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
9835030 |
atccccgtgagcttagctcagttggtagggatattgcatat |
9835070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 11897245 - 11897285
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
11897245 |
atccccgtgagcttagctcagttggtagggatattgcatat |
11897285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 12463753 - 12463793
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
12463753 |
atccccgtgagcttagctcagttggtagggatattgcatat |
12463793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 12891554 - 12891594
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
12891554 |
atccccgtgagcttagctcagttggtagggatattgcatat |
12891594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 16603395 - 16603435
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
16603395 |
atccccgtgagcttagctcagttggtagggatattgcatat |
16603435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 16971619 - 16971659
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
16971619 |
atccccgtgagcttagctcagttggtagagatattgtatat |
16971659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 17545245 - 17545205
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
17545245 |
atccccgtgagcttagctcagttggtagggatattgcatat |
17545205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 21918049 - 21918089
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
21918049 |
atccccgtgagcttagctcagttggtagggatattgcatat |
21918089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 25648158 - 25648118
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
25648158 |
atccccgtgagcttagctcagttggtagggatattgcatat |
25648118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 27765254 - 27765294
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
27765254 |
atccccgtgagcttagctcagttggtagggatattgcatat |
27765294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 32505685 - 32505725
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
32505685 |
atccccgtgagcttagctcagttggtagggatattgcatat |
32505725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 281 - 317
Target Start/End: Original strand, 40081873 - 40081909
Alignment:
| Q |
281 |
taatccccgtgagcttagttcagttggtagagatatt |
317 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40081873 |
taatccccgtgagcttagctcagttggtagagatatt |
40081909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 41179876 - 41179836
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
41179876 |
atccccgtgagcttagctcagttggtagggatattgcatat |
41179836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 42320314 - 42320354
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
42320314 |
atccccgtgagcttagctcagttggtagggatattgcatat |
42320354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 283 - 321
Target Start/End: Complemental strand, 3712139 - 3712101
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcat |
321 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
3712139 |
atccccgtaagcttagctcagttggtagagatattgcat |
3712101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 285 - 323
Target Start/End: Complemental strand, 4745947 - 4745909
Alignment:
| Q |
285 |
ccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
4745947 |
ccccgtgagcttagctcagttggtagggatattgcatat |
4745909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 281 - 323
Target Start/End: Original strand, 5966824 - 5966866
Alignment:
| Q |
281 |
taatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| |||||||||||| |
|
|
| T |
5966824 |
taatccccgtgagcgtagctcagttggtagggatattgcatat |
5966866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 285 - 323
Target Start/End: Complemental strand, 25472654 - 25472616
Alignment:
| Q |
285 |
ccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
25472654 |
ccccgtgagcttagctcagttggtagggatattgcatat |
25472616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 284 - 322
Target Start/End: Original strand, 32550174 - 32550212
Alignment:
| Q |
284 |
tccccgtgagcttagttcagttggtagagatattgcata |
322 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
32550174 |
tccctgtgagcttagttcagttggtagagacattgcata |
32550212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 281 - 323
Target Start/End: Original strand, 42525395 - 42525437
Alignment:
| Q |
281 |
taatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
42525395 |
taatccccgtgagtttagctcagttggtagggatattgcatat |
42525437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 282 - 323
Target Start/End: Original strand, 2328588 - 2328629
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
2328588 |
aatccccgtgagcttagcttagttggtagggatattgcatat |
2328629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 286 - 323
Target Start/End: Complemental strand, 8750971 - 8750934
Alignment:
| Q |
286 |
cccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
8750971 |
cccgtgagcttagttaagttggtagggatattgcatat |
8750934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 282 - 323
Target Start/End: Original strand, 18815344 - 18815385
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
18815344 |
aatccccgtgagcttagctcagttggtaaggatattgcatat |
18815385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 282 - 323
Target Start/End: Complemental strand, 21749451 - 21749410
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||| ||||||| |
|
|
| T |
21749451 |
aatccccgtgagcttagctcagttggtagggatactgcatat |
21749410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 278 - 319
Target Start/End: Complemental strand, 29713454 - 29713413
Alignment:
| Q |
278 |
tcttaatccccgtgagcttagttcagttggtagagatattgc |
319 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
29713454 |
tcttgatccccgtgagcttagctcagttggtagggatattgc |
29713413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 282 - 323
Target Start/End: Original strand, 32706318 - 32706359
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||| ||||| |
|
|
| T |
32706318 |
aatccccgtgagcttagctcagttggtagggatattacatat |
32706359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 286 - 323
Target Start/End: Complemental strand, 35113032 - 35112995
Alignment:
| Q |
286 |
cccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
35113032 |
cccgtgagcttagttcagttgatagggatattgcatat |
35112995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 286 - 323
Target Start/End: Original strand, 35515512 - 35515549
Alignment:
| Q |
286 |
cccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
35515512 |
cccgtgagcttagctcagttggtagggatattgcatat |
35515549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 282 - 323
Target Start/End: Original strand, 42885825 - 42885866
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||| |||||||||||| | |||||||||||||||||||||| |
|
|
| T |
42885825 |
aatctccgtgagcttagctaagttggtagagatattgcatat |
42885866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 287 - 323
Target Start/End: Original strand, 1469726 - 1469762
Alignment:
| Q |
287 |
ccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
1469726 |
ccgtgagtttagctcagttggtagagatattgcatat |
1469762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 2848210 - 2848250
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||| |||| |
|
|
| T |
2848210 |
atccccgtgagcttagctcagttggtagggatattgtatat |
2848250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 5900289 - 5900329
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
5900289 |
atccccgtgagcttaactcagttggtagggatattgcatat |
5900329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 6526047 - 6526087
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||| |||| |
|
|
| T |
6526047 |
atccccgtgagtttagctcagttggtagagatattggatat |
6526087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 6558798 - 6558838
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||| ||||||| |||||||||||| |
|
|
| T |
6558798 |
atccccgtgagcttagctcaattggtagggatattgcatat |
6558838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 8241047 - 8241087
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||| ||||||||| ||||||||||| |||||||||||| |
|
|
| T |
8241047 |
atccccatgagcttagctcagttggtagggatattgcatat |
8241087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 287 - 323
Target Start/End: Original strand, 8968750 - 8968786
Alignment:
| Q |
287 |
ccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
8968750 |
ccgtgagcttagctcagttggtagggatattgcatat |
8968786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 11954328 - 11954288
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||| ||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
11954328 |
atcccggtgagcttagttcagctggtatagatattgcatat |
11954288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 13622019 - 13621979
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||| |||||| |
|
|
| T |
13622019 |
atccccgtgagcttagctcagttggtagggatatcgcatat |
13621979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 319
Target Start/End: Original strand, 24132934 - 24132970
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgc |
319 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
24132934 |
atccccgtgagcttagctcagttgatagagatattgc |
24132970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 33433992 - 33433952
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||| ||||| |||||||||||| ||||||||||| |
|
|
| T |
33433992 |
atccccgtgaacttagctcagttggtagaaatattgcatat |
33433952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 287 - 323
Target Start/End: Original strand, 39165018 - 39165054
Alignment:
| Q |
287 |
ccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
39165018 |
ccgtgagtttagttcagttggtagggatattgcatat |
39165054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 39886285 - 39886245
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||| ||| ||||||||||| |||||||||||| |
|
|
| T |
39886285 |
atccccgtgagcatagctcagttggtagggatattgcatat |
39886245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 39919166 - 39919126
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
39919166 |
atccccgtgagcttagcttagttggtagggatattgcatat |
39919126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 40091474 - 40091514
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
40091474 |
atccccgtgagcttaactcagttggtagggatattgcatat |
40091514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 287 - 323
Target Start/End: Complemental strand, 42842945 - 42842909
Alignment:
| Q |
287 |
ccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
42842945 |
ccgtgagcttagctcagttggtagagatattgtatat |
42842909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000002; HSPs: 57)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 282 - 323
Target Start/End: Complemental strand, 4958630 - 4958589
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
4958630 |
aatccccgtgagcttagttcagttggtagggatattgcatat |
4958589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 55853181 - 55853141
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
55853181 |
atccccgtgagcttagctcagttggtagagatattgcatat |
55853141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 288 - 323
Target Start/End: Original strand, 21432616 - 21432651
Alignment:
| Q |
288 |
cgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
21432616 |
cgtgagcttagttcagttggtagagatattgcatat |
21432651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 283 - 321
Target Start/End: Complemental strand, 7686335 - 7686297
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcat |
321 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7686335 |
atccccgtgagcttagctcagttggtagagatattgcat |
7686297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 281 - 323
Target Start/End: Complemental strand, 43147459 - 43147417
Alignment:
| Q |
281 |
taatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
43147459 |
taatccccgtgagcttagctcagttggtagggatattgcatat |
43147417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 282 - 323
Target Start/End: Complemental strand, 8433697 - 8433656
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
8433697 |
aatccccgtgagcttagctcagttggtagggatattgcatat |
8433656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 282 - 323
Target Start/End: Original strand, 8965090 - 8965131
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
8965090 |
aatccccgtgagcttagctcagttggtagggatattgcatat |
8965131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 282 - 323
Target Start/End: Original strand, 10402437 - 10402478
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
10402437 |
aatccccgtgagcttaactcagttggtagagatattgcatat |
10402478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 282 - 323
Target Start/End: Original strand, 43207665 - 43207706
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
43207665 |
aatccccgtgagcttagctcagttggtagggatattgcatat |
43207706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 282 - 323
Target Start/End: Original strand, 46105531 - 46105572
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
46105531 |
aatccccgtgagcttagctcagttggtagggatattgcatat |
46105572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 280 - 321
Target Start/End: Original strand, 48798273 - 48798314
Alignment:
| Q |
280 |
ttaatccccgtgagcttagttcagttggtagagatattgcat |
321 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
48798273 |
ttaatccccgtgagcttagctcagttggtagggatattgcat |
48798314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 3847678 - 3847718
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
3847678 |
atccccgtgagcttagctcagttggtagggatattgcatat |
3847718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 6371111 - 6371151
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
6371111 |
atccccgtgagcttagctcagttggtagggatattgcatat |
6371151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 23705226 - 23705186
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
23705226 |
atccccgtgagcttagctcagttggtagggatattgcatat |
23705186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 24680159 - 24680119
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
24680159 |
atccccgtgagcttagctcagttggtagggatattgcatat |
24680119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 26868346 - 26868386
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
26868346 |
atccccgtgagcttagctcagttggtagggatattgcatat |
26868386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 26919541 - 26919501
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
26919541 |
atccccgtgagcttagctcagttggtagggatattgcatat |
26919501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 35219573 - 35219533
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
35219573 |
atccccgtgagcttagctcagttggtagggatattgcatat |
35219533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 37935858 - 37935898
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
37935858 |
atccccgtgagcttagctcagttggtagggatattgcatat |
37935898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 39023172 - 39023212
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
39023172 |
atccccgtgagcttagctcagttggtagggatattgcatat |
39023212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 40051619 - 40051659
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
40051619 |
atccccgtgagcttagctcagttggtagggatattgcatat |
40051659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 43596892 - 43596932
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
43596892 |
atccccgtgagcttagctcagttggtagggatattgcatat |
43596932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 45849044 - 45849084
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
45849044 |
atccccgtgagcttagctcagttggtagggatattgcatat |
45849084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 46775103 - 46775063
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
46775103 |
atccccgtgagcttagctcagttggtagggatattgcatat |
46775063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 48569249 - 48569209
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
48569249 |
atccccgtgagcttagctcagttggtagggatattgcatat |
48569209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 49901479 - 49901519
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
49901479 |
atccccgtgagcttagctcagttggtagggatattgcatat |
49901519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 55251424 - 55251384
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
55251424 |
atccccgtgagcttagctcagttggtagggatattgcatat |
55251384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 278 - 321
Target Start/End: Original strand, 35465427 - 35465470
Alignment:
| Q |
278 |
tcttaatccccgtgagcttagttcagttggtagagatattgcat |
321 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
35465427 |
tcttgatccccgtgagcttagctcagttggtagggatattgcat |
35465470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 288 - 323
Target Start/End: Complemental strand, 47230973 - 47230938
Alignment:
| Q |
288 |
cgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |
|
|
| T |
47230973 |
cgtgagcttagctcagttggtagagatattgcatat |
47230938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 280 - 323
Target Start/End: Complemental strand, 53634327 - 53634284
Alignment:
| Q |
280 |
ttaatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||| |||||||||||||||| |||| |||||||||||| |
|
|
| T |
53634327 |
ttaatccccatgagcttagttcagttcgtagggatattgcatat |
53634284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 289 - 323
Target Start/End: Complemental strand, 8848279 - 8848245
Alignment:
| Q |
289 |
gtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
8848279 |
gtgagcttagttcagttggtagggatattgcatat |
8848245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 283 - 321
Target Start/End: Original strand, 44602482 - 44602520
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcat |
321 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
44602482 |
atccccgtgagcttagctcagttggtagggatattgcat |
44602520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 282 - 323
Target Start/End: Original strand, 9761111 - 9761152
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
9761111 |
aatccccgtgagcttacctcagttggtagggatattgcatat |
9761152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 286 - 323
Target Start/End: Complemental strand, 22230504 - 22230467
Alignment:
| Q |
286 |
cccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
22230504 |
cccgtgagcttagctcagttggtagggatattgcatat |
22230467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 286 - 323
Target Start/End: Complemental strand, 22788744 - 22788707
Alignment:
| Q |
286 |
cccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
22788744 |
cccgtgagcttagctcagttggtagggatattgcatat |
22788707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 282 - 323
Target Start/End: Original strand, 30217595 - 30217636
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||| |||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
30217595 |
aatctccgtgagcttagctcagttggtagggatattgcatat |
30217636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 282 - 323
Target Start/End: Original strand, 34353775 - 34353816
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||| |||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
34353775 |
aatctccgtgagcttagctcagttggtagggatattgcatat |
34353816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 286 - 323
Target Start/End: Complemental strand, 40994173 - 40994136
Alignment:
| Q |
286 |
cccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
40994173 |
cccgtgagcttagctcagttggtagggatattgcatat |
40994136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 289 - 322
Target Start/End: Original strand, 42081738 - 42081771
Alignment:
| Q |
289 |
gtgagcttagttcagttggtagagatattgcata |
322 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
42081738 |
gtgagcttagttcagttggcagagatattgcata |
42081771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 282 - 323
Target Start/End: Complemental strand, 43271791 - 43271750
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||| |||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
43271791 |
aatctccgtgagcttagttcagttgatagggatattgcatat |
43271750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 286 - 323
Target Start/End: Original strand, 43978008 - 43978045
Alignment:
| Q |
286 |
cccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
43978008 |
cccgtgagcttagctcagttggtagggatattgcatat |
43978045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 282 - 323
Target Start/End: Original strand, 55536376 - 55536417
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
55536376 |
aatccccgtgagcttagctcagttggtaaggatattgcatat |
55536417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 3036128 - 3036088
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
3036128 |
atccccgtgagcttaactcagttggtagggatattgcatat |
3036088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 3764081 - 3764041
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||| ||||| |
|
|
| T |
3764081 |
atccccgtgagcttagctcagttggtagggatattacatat |
3764041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 4234358 - 4234318
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||| ||| |||||||||||| |
|
|
| T |
4234358 |
atccccgtgagcttagctcagttgatagggatattgcatat |
4234318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 4357879 - 4357919
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||| |||| |
|
|
| T |
4357879 |
atccccgtgaacttagctcagttggtagagatattgtatat |
4357919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 4590243 - 4590283
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
4590243 |
atccccgtgagtttagctcagttggtagggatattgcatat |
4590283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 11375962 - 11375922
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||| ||| |||||||||||| |
|
|
| T |
11375962 |
atccccgtgagcttagctcagttgatagggatattgcatat |
11375922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 25235870 - 25235830
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
25235870 |
atccccgtgagcttagcttagttggtagggatattgcatat |
25235830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 42218747 - 42218787
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||| ||||| ||||||||||| |||||||||||| |
|
|
| T |
42218747 |
atccccgtgaacttagctcagttggtagggatattgcatat |
42218787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 45112184 - 45112144
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
45112184 |
atccccgtgagcttacctcagttggtagggatattgcatat |
45112144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 45126129 - 45126169
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||| |||| |
|
|
| T |
45126129 |
atccccgtgagcttagctcagttggtagggatattgtatat |
45126169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 286 - 322
Target Start/End: Complemental strand, 47678663 - 47678627
Alignment:
| Q |
286 |
cccgtgagcttagttcagttggtagagatattgcata |
322 |
Q |
| |
|
||||||||||||||||||||||||| || |||||||| |
|
|
| T |
47678663 |
cccgtgagcttagttcagttggtagggacattgcata |
47678627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 47934145 - 47934105
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||| |||||| |
|
|
| T |
47934145 |
atccccgtgagcttagctcagttggtagggatatggcatat |
47934105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 51512082 - 51512042
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||| || ||||||||||| |||||||||||| |
|
|
| T |
51512082 |
atccccgtgagctgagctcagttggtagggatattgcatat |
51512042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 52798275 - 52798315
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
52798275 |
atccccgtgagcttaactcagttggtagggatattgcatat |
52798315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 55238572 - 55238532
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
55238572 |
atccccgtgagcttagcttagttggtagggatattgcatat |
55238532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000002; HSPs: 67)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 282 - 323
Target Start/End: Complemental strand, 34102685 - 34102644
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34102685 |
aatccccgtgagcttagttcagttggtagggatattgcatat |
34102644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 34898840 - 34898800
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34898840 |
atccccgtgagcttagttcagttggtagggatattgcatat |
34898800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 50536905 - 50536865
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
50536905 |
atccccgtgagcttagctcagttggtagagatattgcatat |
50536865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 281 - 323
Target Start/End: Complemental strand, 22502006 - 22501964
Alignment:
| Q |
281 |
taatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
22502006 |
taatccccgtgagcttagctcagttggtagggatattgcatat |
22501964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 282 - 323
Target Start/End: Original strand, 7269951 - 7269992
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
7269951 |
aatccccgtgagcttagctcagttggtagggatattgcatat |
7269992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 282 - 323
Target Start/End: Original strand, 7920316 - 7920357
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
7920316 |
aatccccgtgagcttagctcagttggtagggatattgcatat |
7920357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 282 - 323
Target Start/End: Complemental strand, 13638319 - 13638278
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
13638319 |
aatccccgtgagcttagttcagttggtagggatattacatat |
13638278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 278 - 323
Target Start/End: Complemental strand, 31529036 - 31528991
Alignment:
| Q |
278 |
tcttaatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||||| |||| |
|
|
| T |
31529036 |
tcttaatccccgtgagcttagctcagttggtagggatattgaatat |
31528991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 280 - 321
Target Start/End: Complemental strand, 46796005 - 46795964
Alignment:
| Q |
280 |
ttaatccccgtgagcttagttcagttggtagagatattgcat |
321 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
46796005 |
ttaatccccgtgagcttagctcagttggtagggatattgcat |
46795964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 286 - 323
Target Start/End: Complemental strand, 52670223 - 52670186
Alignment:
| Q |
286 |
cccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
52670223 |
cccgtgagcttagttcagttggtagggatattgcatat |
52670186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 882386 - 882426
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
882386 |
atccccgtgagcttagctcagttggtagggatattgcatat |
882426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 2522923 - 2522963
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
2522923 |
atccccgtgagcttagctcagttggtagggatattgcatat |
2522963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 279 - 323
Target Start/End: Complemental strand, 10176980 - 10176936
Alignment:
| Q |
279 |
cttaatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
10176980 |
cttaatccccgtgaggttagctcagttggtagggatattgcatat |
10176936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 19550503 - 19550543
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
19550503 |
atccccgtgagcttagctcagttggtagggatattgcatat |
19550543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 19999864 - 19999904
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
19999864 |
atccccgtgagcttagctcagttggtagggatattgcatat |
19999904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 22472387 - 22472347
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
22472387 |
atccccgtgagcttaactcagttggtagagatattgcatat |
22472347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 28550392 - 28550352
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
28550392 |
atccccgtgagcttagctcagttggtagggatattgcatat |
28550352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 30555300 - 30555260
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
30555300 |
atccccgtgagcttagctcagttggtagggatattgcatat |
30555260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 31327574 - 31327534
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
31327574 |
atccccgtgagcttagctcagttggtagggatattgcatat |
31327534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 31327791 - 31327751
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
31327791 |
atccccgtgagcttagctcagttggtagggatattgcatat |
31327751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 34847540 - 34847580
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
34847540 |
atccccgtgagcttaattcagttggtagggatattgcatat |
34847580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 37800684 - 37800644
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
37800684 |
atccccgtgagcttagctcagttggtagggatattgcatat |
37800644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 39966147 - 39966107
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
39966147 |
atccccgtgagcttagctcagttggtagggatattgcatat |
39966107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 40192153 - 40192193
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
40192153 |
atccccgtgagcttagctcagttggtagggatattgcatat |
40192193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 40548300 - 40548340
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
40548300 |
atccccgtgagcttagctcagttggtagggatattgcatat |
40548340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 40933904 - 40933864
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
40933904 |
atccccgtgagcttagctcagttggtagggatattgcatat |
40933864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 44652055 - 44652015
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
44652055 |
atccccgtgagcttagctcagttggtagggatattgcatat |
44652015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 44685241 - 44685201
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
44685241 |
atccccgtgagcttagcttagttggtagagatattgcatat |
44685201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 45701341 - 45701381
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
45701341 |
atccccgtgagcttagctcagttggtagggatattgcatat |
45701381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 50496887 - 50496847
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
50496887 |
atccccgtgagcttagctcagttggtagggatattgcatat |
50496847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 52410314 - 52410274
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
52410314 |
atccccgtgagcttagctcagttggtagggatattgcatat |
52410274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 52945892 - 52945932
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
52945892 |
atccccgtgagcttagctcagttggtagggatattgcatat |
52945932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 53163591 - 53163631
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
53163591 |
atccccgtgagcttagctcagttggtagggatattgcatat |
53163631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 53347363 - 53347323
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
53347363 |
atccccgtgagcttagctcagttggtagggatattgcatat |
53347323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 280 - 323
Target Start/End: Complemental strand, 25716172 - 25716129
Alignment:
| Q |
280 |
ttaatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||| ||||| |
|
|
| T |
25716172 |
ttaatccccgtgagattagttcagttggtagagttattacatat |
25716129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 284 - 322
Target Start/End: Complemental strand, 4237051 - 4237013
Alignment:
| Q |
284 |
tccccgtgagcttagttcagttggtagagatattgcata |
322 |
Q |
| |
|
||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
4237051 |
tccccgtgagcttagttcagttggtagggacattgcata |
4237013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 285 - 323
Target Start/End: Complemental strand, 6920034 - 6919996
Alignment:
| Q |
285 |
ccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
6920034 |
ccccgtgagcttagctcagttggtagggatattgcatat |
6919996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 283 - 321
Target Start/End: Original strand, 11820001 - 11820039
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcat |
321 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
11820001 |
atccccgtgagcttagctcagttggtagggatattgcat |
11820039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 283 - 321
Target Start/End: Complemental strand, 32256627 - 32256589
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcat |
321 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
32256627 |
atccccgtgagcttagctcagttggtagggatattgcat |
32256589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 283 - 321
Target Start/End: Complemental strand, 48739817 - 48739779
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcat |
321 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
48739817 |
atccccgtgagcttagctcagttggtagggatattgcat |
48739779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 282 - 323
Target Start/End: Complemental strand, 3748676 - 3748635
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||| |||| |
|
|
| T |
3748676 |
aatccccgtgagcttagctcagttggtagggatattgtatat |
3748635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 286 - 323
Target Start/End: Original strand, 3894544 - 3894581
Alignment:
| Q |
286 |
cccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3894544 |
cccgtgagcttagttcagttggtatggatattgcatat |
3894581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 286 - 323
Target Start/End: Original strand, 4139000 - 4139037
Alignment:
| Q |
286 |
cccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
4139000 |
cccgtgagcttagctcagttggtagggatattgcatat |
4139037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 286 - 323
Target Start/End: Original strand, 4541898 - 4541935
Alignment:
| Q |
286 |
cccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
4541898 |
cccgtgagcttagttcagttggtagggatattgtatat |
4541935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 286 - 323
Target Start/End: Complemental strand, 5326106 - 5326069
Alignment:
| Q |
286 |
cccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
5326106 |
cccgtgagcttagctcagttggtagcgatattgcatat |
5326069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 286 - 323
Target Start/End: Complemental strand, 9176656 - 9176619
Alignment:
| Q |
286 |
cccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
9176656 |
cccgtgagcttagctcagttggtagggatattgcatat |
9176619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 281 - 318
Target Start/End: Original strand, 11234437 - 11234474
Alignment:
| Q |
281 |
taatccccgtgagcttagttcagttggtagagatattg |
318 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
11234437 |
taatccccgtgagcttagctcagttagtagagatattg |
11234474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 282 - 323
Target Start/End: Original strand, 13018785 - 13018826
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||| ||| ||||||||||||| |||||||||||||||| |
|
|
| T |
13018785 |
aatccccttgaacttagttcagttgatagagatattgcatat |
13018826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 278 - 323
Target Start/End: Original strand, 15975144 - 15975189
Alignment:
| Q |
278 |
tcttaatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||| ||||| |||||||||| ||||||||||| |||||||||||| |
|
|
| T |
15975144 |
tctttatccctgtgagcttagctcagttggtagggatattgcatat |
15975189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 282 - 323
Target Start/End: Complemental strand, 19996526 - 19996485
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||| ||| ||||||||||| |||||||||||| |
|
|
| T |
19996526 |
aatccccgtgagcgtagctcagttggtagggatattgcatat |
19996485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 286 - 323
Target Start/End: Original strand, 24430146 - 24430183
Alignment:
| Q |
286 |
cccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
24430146 |
cccgtgagcttagctcagttggtagagatattgtatat |
24430183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 286 - 323
Target Start/End: Original strand, 34757529 - 34757566
Alignment:
| Q |
286 |
cccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
34757529 |
cccgtgagcttagctcagttggtagggatattgcatat |
34757566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 280 - 317
Target Start/End: Original strand, 39300378 - 39300415
Alignment:
| Q |
280 |
ttaatccccgtgagcttagttcagttggtagagatatt |
317 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
39300378 |
ttaatccccgtgagcttagctcagttggtagggatatt |
39300415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 286 - 323
Target Start/End: Original strand, 47098732 - 47098769
Alignment:
| Q |
286 |
cccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
47098732 |
cccgtgagcttagctcagttggtagggatattgcatat |
47098769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 286 - 323
Target Start/End: Original strand, 48546173 - 48546210
Alignment:
| Q |
286 |
cccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
48546173 |
cccgtgagcttagctcagttggtagtgatattgcatat |
48546210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 8964849 - 8964809
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
8964849 |
atccccgtgagtttagctcagttggtagggatattgcatat |
8964809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 10349402 - 10349442
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||| ||| |||||||||||| |
|
|
| T |
10349402 |
atccccgtgagcttagctcagttgatagggatattgcatat |
10349442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 10482926 - 10482886
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||| ||||| ||||||||||| |||||||||||| |
|
|
| T |
10482926 |
atccccgtgaacttagctcagttggtagggatattgcatat |
10482886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 17218485 - 17218525
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||| ||||||||| ||||||||||| |||||||||||| |
|
|
| T |
17218485 |
atccccatgagcttagctcagttggtagggatattgcatat |
17218525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 18194335 - 18194375
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
18194335 |
atccccgtgagtttagctcagttggtagggatattgcatat |
18194375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 25939003 - 25938963
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
25939003 |
atccccgtgagtttagctcagttggtagggatattgcatat |
25938963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 28689745 - 28689705
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||| ||||| ||||||||||| |||||||||||| |
|
|
| T |
28689745 |
atccccgtgaacttagctcagttggtagggatattgcatat |
28689705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 30779640 - 30779600
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||| ||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
30779640 |
atcctcgtgagcttagctcagttggtagggatattgcatat |
30779600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 31586944 - 31586984
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||| ||||||||| ||||||||||| |||||||||||| |
|
|
| T |
31586944 |
atccccatgagcttagctcagttggtagggatattgcatat |
31586984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 41936480 - 41936440
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||| ||||||| ||||||||||| |||||||||||| |
|
|
| T |
41936480 |
atccccgtaagcttagctcagttggtagggatattgcatat |
41936440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 287 - 323
Target Start/End: Original strand, 45198724 - 45198760
Alignment:
| Q |
287 |
ccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
45198724 |
ccgttagcttagttcagttggtagggatattgcatat |
45198760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 52974126 - 52974086
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
52974126 |
atccccgtgagcttaactcagttggtagggatattgcatat |
52974086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000003; HSPs: 48)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 280 - 323
Target Start/End: Original strand, 19612709 - 19612752
Alignment:
| Q |
280 |
ttaatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
19612709 |
ttaattcccgtgagcttagttcagttggtagggatattgcatat |
19612752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 282 - 323
Target Start/End: Original strand, 4183172 - 4183213
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
4183172 |
aatccccgtgagcttagctcagttggtagggatattgcatat |
4183213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 3446727 - 3446767
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
3446727 |
atccccgtgagcttagctcagttggtagggatattgcatat |
3446767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 8250374 - 8250334
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
8250374 |
atccccgtgagcttagctcagttggtagggatattgcatat |
8250334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 18694782 - 18694822
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
18694782 |
atccccgtgagcttagctcagttggtagggatattgcatat |
18694822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 19281605 - 19281645
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
19281605 |
atccccgtgagcttagctcagttggtagggatattgcatat |
19281645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 19684070 - 19684110
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
19684070 |
atccccgtgagcttagctcagttggtagggatattgcatat |
19684110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 22653717 - 22653677
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
22653717 |
atccccgtgagcttagctcagttggtagggatattgcatat |
22653677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 25857368 - 25857328
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
25857368 |
atccccgtgagcttagctcagttggtagggatattgcatat |
25857328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 27297172 - 27297212
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
27297172 |
atccccgtgagcttagctcagttggtagggatattgcatat |
27297212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 33229006 - 33228966
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
33229006 |
atccccgtgagcttagctcagttggtagggatattgcatat |
33228966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 38400307 - 38400347
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
38400307 |
atccccgtgagcttagctcagttggtagggatattgcatat |
38400347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 44948593 - 44948633
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
44948593 |
atccccgtgagcttagctcagttggtagggatattgcatat |
44948633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 280 - 323
Target Start/End: Complemental strand, 33233298 - 33233255
Alignment:
| Q |
280 |
ttaatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
33233298 |
ttaatccccgtgagcttatctcagttggtagggatattgcatat |
33233255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 283 - 321
Target Start/End: Original strand, 1260182 - 1260220
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcat |
321 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
1260182 |
atccccgtgagcttagctcagttggtagggatattgcat |
1260220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 281 - 323
Target Start/End: Original strand, 1844812 - 1844854
Alignment:
| Q |
281 |
taatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||| ||||||| ||||||||||| |||||||||||| |
|
|
| T |
1844812 |
taatccccgtaagcttagctcagttggtagggatattgcatat |
1844854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 283 - 321
Target Start/End: Original strand, 16040238 - 16040276
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcat |
321 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
16040238 |
atcctcgtgagcttagttcagttggtagggatattgcat |
16040276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 285 - 323
Target Start/End: Original strand, 34613978 - 34614016
Alignment:
| Q |
285 |
ccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
34613978 |
ccccgtgagcttagctcagttggtagggatattgcatat |
34614016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 284 - 322
Target Start/End: Complemental strand, 35429674 - 35429636
Alignment:
| Q |
284 |
tccccgtgagcttagttcagttggtagagatattgcata |
322 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
35429674 |
tccccgtgagcttagctcagttggtagagacattgcata |
35429636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 286 - 323
Target Start/End: Complemental strand, 8742894 - 8742857
Alignment:
| Q |
286 |
cccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
8742894 |
cccgtgagcttagctcagttggtagagatattacatat |
8742857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 290 - 323
Target Start/End: Original strand, 31223624 - 31223657
Alignment:
| Q |
290 |
tgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
31223624 |
tgagcttagttcagttggtagggatattgcatat |
31223657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 282 - 323
Target Start/End: Complemental strand, 44857308 - 44857267
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||| ||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
44857308 |
aatcctcgtgagcttagctcagttggtagggatattgcatat |
44857267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 2289607 - 2289647
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
2289607 |
atccccgtgagcttagctcagttggtaggaatattgcatat |
2289647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 2643694 - 2643734
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||| ||| ||||||||||| |||||||||||| |
|
|
| T |
2643694 |
atccccgtgagcatagctcagttggtagggatattgcatat |
2643734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 3438945 - 3438985
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||| ||| ||||||||||| |||||||||||| |
|
|
| T |
3438945 |
atccccgtgagcgtagctcagttggtagggatattgcatat |
3438985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 4562825 - 4562785
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
4562825 |
atccccgtgagtttagctcagttggtagggatattgcatat |
4562785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 5062294 - 5062334
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
5062294 |
atccccgtgagcttaactcagttggtagggatattgcatat |
5062334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 5474903 - 5474943
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| |||||||| || |||||||||||| |
|
|
| T |
5474903 |
atccccgtgagcttagctcagttggcagggatattgcatat |
5474943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 5521293 - 5521253
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||| ||| |||||||||||| |
|
|
| T |
5521293 |
atccccgtgagcttagctcagttgatagggatattgcatat |
5521253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 6331559 - 6331599
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||| ||| ||||||||||| |||||||||||| |
|
|
| T |
6331559 |
atccccgtgagcatagctcagttggtagggatattgcatat |
6331599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 7907616 - 7907576
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||||| | ||||||| |||||||||||| |
|
|
| T |
7907616 |
atccccgtgagcttagtttaattggtagggatattgcatat |
7907576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 11050830 - 11050790
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||| ||||| |
|
|
| T |
11050830 |
atccccgtgagcttagctcagttggtagggatattacatat |
11050790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 11144287 - 11144247
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||| |||| |||||||||||| ||||||||||| |
|
|
| T |
11144287 |
atccccgtgagtttagctcagttggtagaaatattgcatat |
11144247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 15233410 - 15233450
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||| ||||||| |||||||||||| |
|
|
| T |
15233410 |
atccccgtgagcttagctcaattggtagggatattgcatat |
15233450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 15485659 - 15485699
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
15485659 |
atccccgtgagcttagctcagttggtaaggatattgcatat |
15485699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 15764927 - 15764967
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||| ||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
15764927 |
atcctcgtgagcttagctcagttggtagggatattgcatat |
15764967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 17034732 - 17034772
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||| ||||||| |||||||||||| |
|
|
| T |
17034732 |
atccccgtgagcttagctcaattggtagggatattgcatat |
17034772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 17078454 - 17078494
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||| |||| |
|
|
| T |
17078454 |
atccccgtgagcttagctcagttggtagggatattgtatat |
17078494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 18278490 - 18278450
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
18278490 |
atccccgtgagtttagctcagttggtagggatattgcatat |
18278450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 287 - 323
Target Start/End: Original strand, 27016278 - 27016314
Alignment:
| Q |
287 |
ccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |
|
|
| T |
27016278 |
ccgtgagcttagttcagttggtatggatattgcatat |
27016314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 28195207 - 28195167
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||| ||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
28195207 |
atcctcgtgagcttagctcagttggtagggatattgcatat |
28195167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 30932519 - 30932479
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
30932519 |
atccccgtgagcttacctcagttggtagggatattgcatat |
30932479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 33549127 - 33549087
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||| |||| |
|
|
| T |
33549127 |
atccccgtgagcttagctcagttgatagagatattgtatat |
33549087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 35798099 - 35798059
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
35798099 |
atccccgtgagcttaactcagttgttagagatattgcatat |
35798059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 39408763 - 39408723
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
39408763 |
atccccgtgagcttaactcagttggtagggatattgcatat |
39408723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 40535522 - 40535482
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
40535522 |
atccccgtgagcttagctcagttggtacggatattgcatat |
40535482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 287 - 323
Target Start/End: Original strand, 41286132 - 41286168
Alignment:
| Q |
287 |
ccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
41286132 |
ccgtgagcttggttcagttggtagggatattgcatat |
41286168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 287 - 323
Target Start/End: Original strand, 41509517 - 41509553
Alignment:
| Q |
287 |
ccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
41509517 |
ccgtgagcttagctcagttggtagggatattgcatat |
41509553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0088 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0088
Description:
Target: scaffold0088; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 281 - 323
Target Start/End: Complemental strand, 10901 - 10859
Alignment:
| Q |
281 |
taatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
10901 |
taatccccgtgagcttagctcagttggtagggatattgcatat |
10859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.0000000001; HSPs: 63)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 283 - 321
Target Start/End: Complemental strand, 5326243 - 5326205
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcat |
321 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5326243 |
atccccgtgagcttagctcagttggtagagatattgcat |
5326205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 281 - 323
Target Start/End: Original strand, 28909460 - 28909502
Alignment:
| Q |
281 |
taatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
28909460 |
taatccccgtgagcttagctcagttggtagggatattgcatat |
28909502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 283 - 321
Target Start/End: Original strand, 39587544 - 39587582
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcat |
321 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
39587544 |
atccccgtgagcttagctcagttggtagagatattgcat |
39587582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 282 - 323
Target Start/End: Complemental strand, 10736948 - 10736907
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
10736948 |
aatccccgtgagcttagctcagttggtagggatattgcatat |
10736907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 282 - 323
Target Start/End: Original strand, 11875882 - 11875923
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
11875882 |
aatccccgtgagcttagctcagttggtagggatattgcatat |
11875923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 282 - 323
Target Start/End: Original strand, 11890889 - 11890930
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
11890889 |
aatccccgtgagcttagctcagttggtagggatattgcatat |
11890930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 282 - 323
Target Start/End: Original strand, 16449121 - 16449162
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
16449121 |
aatccccgtgagcttagctcagttggtagggatattgcatat |
16449162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 282 - 323
Target Start/End: Original strand, 26022243 - 26022284
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
26022243 |
aatccccgtgagcttagctcagttggtagggatattgcatat |
26022284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 282 - 323
Target Start/End: Original strand, 34413058 - 34413099
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
34413058 |
aatccccgtgagcttagctcagttggtagggatattgcatat |
34413099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 12298 - 12258
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
12298 |
atccccgtgagcttagctcagttggtagggatattgcatat |
12258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 94584 - 94544
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
94584 |
atccccgtgagcttagctcagttggtagggatattgcatat |
94544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 1937307 - 1937347
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
1937307 |
atccccgtgagcttagctcagttggtagggatattgcatat |
1937347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 8265265 - 8265305
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
8265265 |
atccccgtgagcttagctcagttggtagggatattgcatat |
8265305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 10200754 - 10200714
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
10200754 |
atcctcgtgagcttagctcagttggtagagatattgcatat |
10200714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 17027953 - 17027913
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
17027953 |
atccccgtgagcttagctcagttggtagggatattgcatat |
17027913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 17558389 - 17558349
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
17558389 |
atccccgtgagcttagctcagttggtagggatattgcatat |
17558349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 17698519 - 17698559
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
17698519 |
atccccgtgagcttagctcagttggtagggatattgcatat |
17698559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 29716857 - 29716897
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
29716857 |
atccccgtgagcttagctcagttggtagggatattgcatat |
29716897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 29729115 - 29729155
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
29729115 |
atccccgtgagtttagttcagttggtagggatattgcatat |
29729155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 30972890 - 30972850
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
30972890 |
atccccgtgagcttagctcagttggtagggatattgcatat |
30972850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 32719680 - 32719640
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
32719680 |
atccccgtgagcttagctcagttggtagggatattgcatat |
32719640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 35939484 - 35939524
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
35939484 |
atccccgtgagcttagctcagttggtagggatattgcatat |
35939524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 38745352 - 38745312
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
38745352 |
atccccgtgagcttagctcagttggtagggatattgcatat |
38745312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 39362262 - 39362302
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
39362262 |
atccccgtgagcttagctcagttggtagggatattgcatat |
39362302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 41689879 - 41689919
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
41689879 |
atccccgtgagcttagctcagttggtagggatattgcatat |
41689919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 43656033 - 43656073
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
43656033 |
atccccgtgagcttagctcagttggtagggatattgcatat |
43656073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 44340418 - 44340378
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
44340418 |
atccccgtgagcttagctcagttggtagggatattgcatat |
44340378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 286 - 321
Target Start/End: Complemental strand, 11297063 - 11297028
Alignment:
| Q |
286 |
cccgtgagcttagttcagttggtagagatattgcat |
321 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |
|
|
| T |
11297063 |
cccgtgagcttagttcagttggtagggatattgcat |
11297028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 284 - 323
Target Start/End: Complemental strand, 23178963 - 23178924
Alignment:
| Q |
284 |
tccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
23178963 |
tccccgtgagcttagctcagttggtagggatattgcatat |
23178924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 288 - 323
Target Start/End: Complemental strand, 26192784 - 26192749
Alignment:
| Q |
288 |
cgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |
|
|
| T |
26192784 |
cgtgagcttagttcagttggtagggatattgcatat |
26192749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 281 - 323
Target Start/End: Complemental strand, 2787156 - 2787114
Alignment:
| Q |
281 |
taatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||| |||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
2787156 |
taatctccgtgagcttagctcagttggtagggatattgcatat |
2787114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 285 - 323
Target Start/End: Complemental strand, 4615747 - 4615709
Alignment:
| Q |
285 |
ccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
4615747 |
ccccgtgagtttagttcagttggtagggatattgcatat |
4615709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 281 - 323
Target Start/End: Complemental strand, 20540181 - 20540139
Alignment:
| Q |
281 |
taatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||||| ||||||| ||| |||||||||||| |
|
|
| T |
20540181 |
taatccccgtgagcttagctcagttgttagggatattgcatat |
20540139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 282 - 323
Target Start/End: Original strand, 2792775 - 2792816
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||||| ||||||| ||| |||||||||||| |
|
|
| T |
2792775 |
aatccccgtgagcttagctcagttgatagggatattgcatat |
2792816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 290 - 323
Target Start/End: Original strand, 7194266 - 7194299
Alignment:
| Q |
290 |
tgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
7194266 |
tgagcttagttcagttggtagggatattgcatat |
7194299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 282 - 323
Target Start/End: Original strand, 26734068 - 26734109
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||| ||||||| |||||||||||| ||||||||||| |
|
|
| T |
26734068 |
aatccccgtaagcttagctcagttggtagatatattgcatat |
26734109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 286 - 323
Target Start/End: Complemental strand, 34158727 - 34158690
Alignment:
| Q |
286 |
cccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
34158727 |
cccgtgagcttagctcagttggtagggatattgcatat |
34158690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 282 - 323
Target Start/End: Original strand, 34894365 - 34894406
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||| ||||||| ||||||||||| |||||||||||| |
|
|
| T |
34894365 |
aatccccgtaagcttagctcagttggtagggatattgcatat |
34894406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 280 - 321
Target Start/End: Original strand, 36540281 - 36540322
Alignment:
| Q |
280 |
ttaatccccgtgagcttagttcagttggtagagatattgcat |
321 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
36540281 |
ttaatccccgtgagcttaactcagttggtagggatattgcat |
36540322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 282 - 323
Target Start/End: Original strand, 37717359 - 37717400
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
37717359 |
aatccccgtgagcttaactcagttggtagggatattgcatat |
37717400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 282 - 323
Target Start/End: Complemental strand, 43284040 - 43283999
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
43284040 |
aatccccgtgagtttagctcagttggtagggatattgcatat |
43283999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 290 - 323
Target Start/End: Original strand, 43403296 - 43403329
Alignment:
| Q |
290 |
tgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |
|
|
| T |
43403296 |
tgagcttaattcagttggtagagatattgcatat |
43403329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 133412 - 133452
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||| ||| |||||||||||| |
|
|
| T |
133412 |
atccccgtgagcttagctcagttgatagggatattgcatat |
133452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 3227071 - 3227032
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
3227071 |
atccccgtgagattagttcagttggtag-gatattgcatat |
3227032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 6280477 - 6280517
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||| |||| |
|
|
| T |
6280477 |
atccccgtgagcttagctcagttggtagggatattgaatat |
6280517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 6659286 - 6659326
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
6659286 |
atccccgtgagattagctcagttggtagggatattgcatat |
6659326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 6739688 - 6739728
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
6739688 |
atccccgtgagattagctcagttggtagggatattgcatat |
6739728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 291 - 323
Target Start/End: Complemental strand, 7764004 - 7763972
Alignment:
| Q |
291 |
gagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
7764004 |
gagcttagctcagttggtagagatattgcatat |
7763972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 8034485 - 8034445
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
8034485 |
atccccgtgagcttaactcagttggtagggatattgcatat |
8034445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 10030409 - 10030449
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||| ||||| |||| |||||||||||||||||||||||| |
|
|
| T |
10030409 |
atccctgtgagtttagctcagttggtagagatattgcatat |
10030449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 10568082 - 10568122
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
10568082 |
atccccgtgagtttagctcagttggtagggatattgcatat |
10568122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 285 - 321
Target Start/End: Complemental strand, 10594287 - 10594251
Alignment:
| Q |
285 |
ccccgtgagcttagttcagttggtagagatattgcat |
321 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
10594287 |
ccccgtgagcttagtttagttggtagggatattgcat |
10594251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 14876675 - 14876635
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| || ||||||||| |
|
|
| T |
14876675 |
atccccgtgagcttagctcagttggtagggaaattgcatat |
14876635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 287 - 323
Target Start/End: Original strand, 23858198 - 23858234
Alignment:
| Q |
287 |
ccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
23858198 |
ccgtgagcttagctcagttggtagggatattgcatat |
23858234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 281 - 321
Target Start/End: Complemental strand, 26280859 - 26280819
Alignment:
| Q |
281 |
taatccccgtgagcttagttcagttggtagagatattgcat |
321 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
26280859 |
taatccccgtgagcttaactcagttggtagggatattgcat |
26280819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 26567321 - 26567281
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||| ||| |||||||||||| |
|
|
| T |
26567321 |
atccccgtgagcttagctcagttgatagggatattgcatat |
26567281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 29514623 - 29514663
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||| |||| |
|
|
| T |
29514623 |
atccccgtgagcttagctcagttggtagggatattgtatat |
29514663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 33617969 - 33618009
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
33617969 |
atccccgtgagcttaactcagttggtagggatattgcatat |
33618009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 34266009 - 34266049
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||| |||||||| ||||||||||| |||||||||||| |
|
|
| T |
34266009 |
atccccgcgagcttagctcagttggtagggatattgcatat |
34266049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 291 - 323
Target Start/End: Complemental strand, 37524272 - 37524240
Alignment:
| Q |
291 |
gagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
37524272 |
gagcttagctcagttggtagagatattgcatat |
37524240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 38219641 - 38219601
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||| ||| ||||||||||| |||||||||||| |
|
|
| T |
38219641 |
atccccgtgagcatagctcagttggtagggatattgcatat |
38219601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 42880945 - 42880985
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
42880945 |
atccccgtgagcttaactcagttggtagggatattgcatat |
42880985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 287 - 323
Target Start/End: Complemental strand, 43980382 - 43980346
Alignment:
| Q |
287 |
ccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
43980382 |
ccgtgagcttagttcagttgttagggatattgcatat |
43980346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0275 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: scaffold0275
Description:
Target: scaffold0275; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 280 - 321
Target Start/End: Original strand, 8815 - 8856
Alignment:
| Q |
280 |
ttaatccccgtgagcttagttcagttggtagagatattgcat |
321 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
8815 |
ttaatccccgtgagcttagctcagttggtagggatattgcat |
8856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000005; HSPs: 41)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 282 - 323
Target Start/End: Original strand, 2228971 - 2229012
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
2228971 |
aatccccgtgagcttagctcagttggtagggatattgcatat |
2229012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 282 - 323
Target Start/End: Complemental strand, 37300173 - 37300132
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
37300173 |
aatccccgtgagcttagctcagttggtagggatattgcatat |
37300132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 282 - 323
Target Start/End: Original strand, 42443685 - 42443726
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
42443685 |
aatccccgtgagcttagctcagttggtagggatattgcatat |
42443726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 282 - 323
Target Start/End: Original strand, 47999776 - 47999817
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
47999776 |
aatccccgtgagcttagctcagttggtagggatattgcatat |
47999817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 2681093 - 2681133
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
2681093 |
atccccgtgagcttagctcagttggtagggatattgcatat |
2681133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 9877340 - 9877300
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
9877340 |
atccccgtgagcttagctcagttggtagggatattgcatat |
9877300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 10244962 - 10244922
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
10244962 |
atccccgtgagcttagctcagttggtagggatattgcatat |
10244922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 12640662 - 12640622
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
12640662 |
atccccgtgagcttagctcagttggtagggatattgcatat |
12640622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 15238886 - 15238926
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
15238886 |
atccccgtgagcttagctcagttggtagggatattgcatat |
15238926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 19753041 - 19753001
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
19753041 |
atccccgtgagcttagctcagttggtagggatattgcatat |
19753001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 23102631 - 23102591
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
23102631 |
atccccgtgagcttagctcagttggtagggatattgcatat |
23102591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 25833552 - 25833592
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
25833552 |
atccccgtgagcttagctcagttggtagggatattgcatat |
25833592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 29617402 - 29617442
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
29617402 |
atccccgtgagcttagctcagttggtagggatattgcatat |
29617442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 30940768 - 30940808
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
30940768 |
atccccgtgagcttagctcagttggtagtgatattgcatat |
30940808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 35950125 - 35950165
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
35950125 |
atccccgtgagcttagctcagttggtagggatattgcatat |
35950165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 39098133 - 39098173
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
39098133 |
atccctgtgagcttagttcagttggtagggatattgcatat |
39098173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 44616599 - 44616639
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
44616599 |
atccccgtgagcttagctcagttggtagggatattgcatat |
44616639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 47641042 - 47641082
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
47641042 |
atccccgtgagcttagctcagttggtagggatattgcatat |
47641082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 281 - 323
Target Start/End: Original strand, 7525439 - 7525481
Alignment:
| Q |
281 |
taatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
7525439 |
taatccccgtgagtttagttcagttggtaaggatattgcatat |
7525481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 281 - 323
Target Start/End: Complemental strand, 27510332 - 27510290
Alignment:
| Q |
281 |
taatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||| ||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
27510332 |
taattcccgtgagcttagctcagttggtagggatattgcatat |
27510290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 282 - 323
Target Start/End: Original strand, 10226671 - 10226712
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||| |||||||| |
|
|
| T |
10226671 |
aatccccgtgagtttagttcagttggtagggatgttgcatat |
10226712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 286 - 323
Target Start/End: Original strand, 24781030 - 24781067
Alignment:
| Q |
286 |
cccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
24781030 |
cccgtgagcttagctcagttggtagggatattgcatat |
24781067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 282 - 323
Target Start/End: Original strand, 27424835 - 27424876
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||||| |||||||| || |||||||||||| |
|
|
| T |
27424835 |
aatccccgtgagcttagctcagttggaagggatattgcatat |
27424876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 282 - 323
Target Start/End: Original strand, 30806111 - 30806152
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
30806111 |
aatccccgtgagtttagctcagttggtagggatattgcatat |
30806152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 282 - 323
Target Start/End: Original strand, 31026215 - 31026256
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||| ||| ||||||||||| |||||||||||| |
|
|
| T |
31026215 |
aatccccgtgagcgtagctcagttggtagggatattgcatat |
31026256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 282 - 323
Target Start/End: Original strand, 36174386 - 36174427
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||| |||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
36174386 |
aatctccgtgagcttagctcagttggtagggatattgcatat |
36174427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 286 - 323
Target Start/End: Complemental strand, 36391974 - 36391937
Alignment:
| Q |
286 |
cccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
36391974 |
cccgtgagcttagctcagttggtagggatattgcatat |
36391937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 282 - 323
Target Start/End: Original strand, 41084035 - 41084076
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||| |||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
41084035 |
aatcgccgtgagcttagctcagttggtagggatattgcatat |
41084076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 282 - 323
Target Start/End: Complemental strand, 46534822 - 46534781
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||| ||||||||| ||||||||||| |||||||||||| |
|
|
| T |
46534822 |
aatccccatgagcttagctcagttggtagggatattgcatat |
46534781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 3766808 - 3766848
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
3766808 |
atccccgtgagcttaactcagttggtagggatattgcatat |
3766848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 5073264 - 5073304
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
5073264 |
atccccgtgagcttaactcagttggtagagatattgtatat |
5073304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 5990218 - 5990178
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||| |||| |
|
|
| T |
5990218 |
atccccgtgagcttagctcagttggtagggatattgtatat |
5990178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 12772112 - 12772152
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||| ||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
12772112 |
atcctcgtgagcttagctcagttggtagggatattgcatat |
12772152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 15694547 - 15694587
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||| |||| |
|
|
| T |
15694547 |
atccccgtgagcttaattcagttggtagggatattgtatat |
15694587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 15701527 - 15701567
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||| |||| |
|
|
| T |
15701527 |
atccccgtgagcttaattcagttggtagggatattgtatat |
15701567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 21066883 - 21066923
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
21066883 |
atccccgtgagtttagctcagttggtagggatattgcatat |
21066923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 24061402 - 24061362
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
24061402 |
atccccgtgagcttagctcagttggtaggaatattgcatat |
24061362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 24508823 - 24508863
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||| |||||| ||||||||||||||| |||||||||||| |
|
|
| T |
24508823 |
atcccagtgagcgtagttcagttggtagggatattgcatat |
24508863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 24692472 - 24692512
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
24692472 |
atccccgtgaggttagctcagttggtagggatattgcatat |
24692512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 36469778 - 36469738
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||| ||||| |
|
|
| T |
36469778 |
atccccgtgagcttagctcagttggtagggatattacatat |
36469738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 38889566 - 38889526
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
38889566 |
atccccgtgagcttaactcagttggtagggatattgcatat |
38889526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0707 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0707
Description:
Target: scaffold0707; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 93 - 53
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
93 |
atccccgtgagcttagctcagttggtagggatattgcatat |
53 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0608 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0608
Description:
Target: scaffold0608; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 8963 - 9003
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
8963 |
atccccgtgagcttagctcagttggtagggatattgcatat |
9003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0445 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0445
Description:
Target: scaffold0445; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 4087 - 4047
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
4087 |
atccccgtgagcttagctcagttggtagggatattgcatat |
4047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0128 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0128
Description:
Target: scaffold0128; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 17617 - 17657
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
17617 |
atccccgtgagcttagctcagttggtagggatattgcatat |
17657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0121
Description:
Target: scaffold0121; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 46523 - 46563
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
46523 |
atccccgtgagcttagctcagttggtagggatattgcatat |
46563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0100 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0100
Description:
Target: scaffold0100; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 45881 - 45921
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
45881 |
atccccgtgagcttagctcagttggtagggatattgcatat |
45921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 59780 - 59820
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
59780 |
atccccgtgagcttagctcagttggtagggatattgcatat |
59820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0010 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0010
Description:
Target: scaffold0010; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 236428 - 236388
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
236428 |
atccccgtgagattagttcagttggtagggatattgcatat |
236388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 266770 - 266730
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
266770 |
atccccgtgagcttagctcagttggtagggatattgcatat |
266730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0006 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0006
Description:
Target: scaffold0006; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 291 - 323
Target Start/End: Complemental strand, 59243 - 59211
Alignment:
| Q |
291 |
gagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
59243 |
gagcttagttcagttggtagagatattgcatat |
59211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 8898 - 8858
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
8898 |
atccccgtgagcttagctcagttggtagggatattgcatat |
8858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0460 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0460
Description:
Target: scaffold0460; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 282 - 323
Target Start/End: Original strand, 12455 - 12496
Alignment:
| Q |
282 |
aatccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||| ||| ||||||||||| |||||||||||| |
|
|
| T |
12455 |
aatccccgtgagcgtagctcagttggtagggatattgcatat |
12496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0366 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0366
Description:
Target: scaffold0366; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 286 - 323
Target Start/End: Complemental strand, 930 - 893
Alignment:
| Q |
286 |
cccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
930 |
cccgtgagcttagctcagttggtagggatattgcatat |
893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 286 - 323
Target Start/End: Complemental strand, 12331 - 12294
Alignment:
| Q |
286 |
cccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
12331 |
cccgtgagcttagctcagttggtagggatattgcatat |
12294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1185 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold1185
Description:
Target: scaffold1185; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Complemental strand, 2446 - 2406
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
|||||||||||| ||| ||||||||||| |||||||||||| |
|
|
| T |
2446 |
atccccgtgagcgtagctcagttggtagggatattgcatat |
2406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 112105 - 112145
Alignment:
| Q |
283 |
atccccgtgagcttagttcagttggtagagatattgcatat |
323 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
112105 |
atccccgtgagcttaactcagttggtagggatattgcatat |
112145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University