View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2371_low_61 (Length: 278)
Name: NF2371_low_61
Description: NF2371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2371_low_61 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 18 - 261
Target Start/End: Original strand, 27560951 - 27561194
Alignment:
| Q |
18 |
aaagtcccaccaaacatggccaatagcataacaagcgtagttatttccttccctataaatgtgtgaaaaaactacaaaggatatttttacaaagaaaaag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
27560951 |
aaagtcccaccaaacatggccaatagcataacaagcgtagttatttccttccctataaatgtgtgaaaaaactacaaaggatatctttacaaataaaaag |
27561050 |
T |
|
| Q |
118 |
acaattttacaaccgacttctaattgacaacgagacagcgtgaacatttgtgaagacatcaatgaccaaattggaatcattttccaatcaaagactgtgc |
217 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27561051 |
acaattttacaaccgacttctaatggacaacgagacagcgtgaacatttgtgaagacatcaatgaccaaattggaatcattttccaatcaaagactgtgc |
27561150 |
T |
|
| Q |
218 |
cagcccctatggtgaaaaatcttcaccaccagcatagctgcaca |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27561151 |
cagcccctatggtgaaaaatcttcaccaccagcatagctgcaca |
27561194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 212 - 261
Target Start/End: Original strand, 27561245 - 27561294
Alignment:
| Q |
212 |
ctgtgccagcccctatggtgaaaaatcttcaccaccagcatagctgcaca |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
27561245 |
ctgtgccagcccctatggtgaaaaatcttcatcaccagcaaagctgcaca |
27561294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University