View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2371_low_83 (Length: 242)
Name: NF2371_low_83
Description: NF2371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2371_low_83 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 12 - 226
Target Start/End: Original strand, 31441596 - 31441810
Alignment:
| Q |
12 |
aagaatgttggcactcttcaaagctacaatgacaggacctaaacaggagagtattaggcagtcatggatttcaggttttggtcttttcagctcacaattt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31441596 |
aagaatgttggcactcttcaaagctacaatgacaggacctaaacaggagagtattaggcagtcatggatttcaggttttggtcttttcagctcacaattt |
31441695 |
T |
 |
| Q |
112 |
ttcaacacttcatcaacagcattggcatattggtatggtgggagtctcctaataaaaggccaaatagaaccgacggaactcttccaagcatttttaatat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31441696 |
ttcaacacttcatcaacagcattggcatattggtatggtgggagtctcctaataaaaggccaaatagaaccgacggaactcttccaagcatttttaatat |
31441795 |
T |
 |
| Q |
212 |
tgctcttcactgcat |
226 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
31441796 |
tgctcttcactgcat |
31441810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University