View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2371_low_85 (Length: 240)
Name: NF2371_low_85
Description: NF2371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2371_low_85 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 16 - 186
Target Start/End: Original strand, 43369335 - 43369505
Alignment:
| Q |
16 |
tttactactcttcaaatgtgttttccatgcaaacaatatgacataagagatagatctttaagttctttaattatttgatttagagtttgaaaaaatgcca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43369335 |
tttactactcttcaaatgtgttttccatgcaaacaatatgacatgagagatagatctttaagttctttaattatttgatttagagtttgaaaaaatgcca |
43369434 |
T |
|
| Q |
116 |
actactttgaagaacttagtttttaaaattgtgaagagtatcctttgtatataaaaaatgtgtacatgtta |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43369435 |
actactttgaagaacttagtttttaaaattgtgaagagtatcctttgtatataaaaaatgtgtacatgtta |
43369505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University