View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2371_low_95 (Length: 234)
Name: NF2371_low_95
Description: NF2371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2371_low_95 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 13 - 215
Target Start/End: Original strand, 41078243 - 41078444
Alignment:
| Q |
13 |
aatatatttaaagtattatttcctttaatcacgaagnnnnnnnttgttatttggtcagatcataaagataaaattgtaaattagttttaaaatacctctc |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || |||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41078243 |
aatatatttaaagtattatttcctttaatcacgcagaaaaaaattgttatttgatcagatcataaagataaaattgtaaattagttttaaaatatctctc |
41078342 |
T |
 |
| Q |
113 |
ttttcatattttgaaccaaacacatttgtaattaaacttttttcattccacttccctctcctcccctatagaccctaaatggaggctaaatagagtgtag |
212 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41078343 |
ttttcatattttgaaccaaacacattt-taattaaacttttttcattccacttccctctcctcccctatagaccctaaatggaggctaaatagagtgtag |
41078441 |
T |
 |
| Q |
213 |
tga |
215 |
Q |
| |
|
||| |
|
|
| T |
41078442 |
tga |
41078444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University