View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2372_low_1 (Length: 286)
Name: NF2372_low_1
Description: NF2372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2372_low_1 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 55; Significance: 1e-22; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 18 - 76
Target Start/End: Complemental strand, 34847340 - 34847282
Alignment:
| Q |
18 |
agattaatgattgataaacaacgataaacaattgtattgtgtaaactgttgcttaaccc |
76 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34847340 |
agattaatgattgataatcaacgataaacaattgtattgtgtaaactgttgcttaaccc |
34847282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 156 - 231
Target Start/End: Complemental strand, 34847201 - 34847126
Alignment:
| Q |
156 |
ttaactgatttctttctcttannnnnnnnagtttcaacttgactcttttactttgaaagtttcaattgattctctt |
231 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34847201 |
ttaactgatttctttctcttattttttttagtttcaacttgactcttttactttgaaagtttcaattgattctctt |
34847126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 234 - 275
Target Start/End: Complemental strand, 34847029 - 34846988
Alignment:
| Q |
234 |
accgcaattaatttaaacgggatcaccatattcttttttcat |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34847029 |
accgcaattaatttaaacgggatcaccatattcttttttcat |
34846988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University