View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2372_low_5 (Length: 237)

Name: NF2372_low_5
Description: NF2372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2372_low_5
NF2372_low_5
[»] chr1 (1 HSPs)
chr1 (4-221)||(10442803-10443024)
[»] chr5 (1 HSPs)
chr5 (31-63)||(2586443-2586475)


Alignment Details
Target: chr1 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 4 - 221
Target Start/End: Complemental strand, 10443024 - 10442803
Alignment:
4 gtctttacaaactaaaaataccacgcatattaaaatttgctttaaatctcacttacttttgacgattagttaatcgactccttttctatcttcgattgtc 103  Q
    ||||||| ||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||| || ||||||||||||||||||||    
10443024 gtctttaaaaattaaaaataccacacatattaaaatttgctttaaatctcacttacttttgacgattaattaatcggcttcttttctatcttcgattgtc 10442925  T
104 atctctaaaaatgaaaacatttgatatgaaaagct----nnnnnnnnngattttacagtgaacaaatctgtaagatgcgaataatttttaccataaaaat 199  Q
    |||||||||||||||||||||||||||||||| ||             ||||||||||||||||||| |||||||||||||||||||||||||| |||||    
10442924 atctctaaaaatgaaaacatttgatatgaaaaactaaaaaaaaaaaaagattttacagtgaacaaatttgtaagatgcgaataatttttaccatcaaaat 10442825  T
200 tgctattaggttacataaattt 221  Q
    ||||||||||| ||||||||||    
10442824 tgctattaggtcacataaattt 10442803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 63
Target Start/End: Complemental strand, 2586475 - 2586443
Alignment:
31 tattaaaatttgctttaaatctcacttactttt 63  Q
    ||||||||||||||||||| |||||||||||||    
2586475 tattaaaatttgctttaaacctcacttactttt 2586443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University