View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2372_low_6 (Length: 236)
Name: NF2372_low_6
Description: NF2372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2372_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 18196516 - 18196276
Alignment:
| Q |
1 |
aacaagtgaaagatatatggatcacttagtaatctggtcgaaa-tttgatctcttgtcgggttgaatggtaa------------------ttaatccctt |
81 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||| |||| |||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
18196516 |
aacaagtgaaagatacatggatcacttagtaatttggttgaaagtttgatctcttgtcgggttgaatggtaaaacatttgttaggagagattaatccctt |
18196417 |
T |
 |
| Q |
82 |
aaatggatattagttaccctgagggattagtttcatagttacatgcaggagatatcttagtttatccaaaaacactaacaaaaaacctcagcaaatgcac |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18196416 |
aaatggatattagttaccctgagggattagtttcatagttgcatgcaggagatatcttagtttatccaaaaacactaacaaaaaacctcagcaaatgcac |
18196317 |
T |
 |
| Q |
182 |
aagtcgcacggatttggttttcatattagggtaagcaatgt |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18196316 |
aagtcgcacggatttggttttcatattagggtaagcaatgt |
18196276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University