View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2373_high_11 (Length: 246)
Name: NF2373_high_11
Description: NF2373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2373_high_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 100
Target Start/End: Original strand, 39447220 - 39447319
Alignment:
| Q |
1 |
cactaaaccaaatccctaacacnnnnnnnnntcacattacaaaacggttactaacagttagtaactgcaaaattcaaattccttaacaaacacggaattc |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39447220 |
cactaaaccaaatccctaacacaaaaaaaaatcacattacaaaacggttactaacagttagtaactgcaaaattcaaattccttaacaaacacggaattc |
39447319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 192 - 230
Target Start/End: Original strand, 39447411 - 39447449
Alignment:
| Q |
192 |
gaagcggagaaatgttaagtacctttgcttcgtagatgc |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39447411 |
gaagcggagaaatgttaagtacctttgcttcgtagatgc |
39447449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University