View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2373_high_5 (Length: 329)
Name: NF2373_high_5
Description: NF2373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2373_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 123; Significance: 4e-63; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 51 - 242
Target Start/End: Original strand, 9779672 - 9779863
Alignment:
| Q |
51 |
tggtctcctaattttcttgcctttatatgttatgaccctctctgttaacactttgaccttaaatatttgatatgggctaaaattaaaagtggtcctccat |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||| ||||| |||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
9779672 |
tggtctcctaattttcttgcctttatatgttatgaccctctccgttaccacttcaaccttaaataactaatatgggctaaaattaaaagtggtcctccat |
9779771 |
T |
 |
| Q |
151 |
ttactttattaattttttagtttaagcactatgatcnnnnnnnaaaaagaagattgatggatcgtgcagctctattatatcttaccgtgaac |
242 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| ||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
9779772 |
atactttattaattttttagtttaagcactttgatttttttttaaaaagaagattgttggatcgtgcagctctattagatcttaccgtgaac |
9779863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University