View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2373_high_6 (Length: 306)
Name: NF2373_high_6
Description: NF2373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2373_high_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 250; Significance: 1e-139; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 18 - 296
Target Start/End: Complemental strand, 48085431 - 48085153
Alignment:
| Q |
18 |
agaaaatacacacataaactaacnnnnnnncattaaccaaatgtcttggatggattgatcaagtcctggaatctaaggccatgatagtgctgagattcat |
117 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48085431 |
agaaaatacacacataaactaacaaaaaaacattaaccaaatgtcttggatggattgatcaagtcctggaatctaaggccatgatagtgctgagattcat |
48085332 |
T |
 |
| Q |
118 |
gggatacatgtactgagcactgcccctaaggatttggttgactatgattttgtttgccttttcagatggatggaatgcatcccaaaatgcattaagttct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
48085331 |
gggatacatgtactgagcactgcccctaaggattcggttgactatgattttgtttgccttttcagatggatggaatgcatcccaaaaagcattaagttct |
48085232 |
T |
 |
| Q |
218 |
ctgtttgggcacaagtttgaggctggtgtacaaagcccaagtccattgtatggcccttgtccacagcatgctacctttg |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48085231 |
ctgtttgggcacaagtttgaggctggtgtacaaagcccaagtccattgtatggcccttgtccacagcatgctacctttg |
48085153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 164 - 209
Target Start/End: Complemental strand, 48102536 - 48102491
Alignment:
| Q |
164 |
attttgtttgccttttcagatggatggaatgcatcccaaaatgcat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48102536 |
attttgtttgccttttcagatggatggaatgcatcccaaaatgcat |
48102491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 170 - 234
Target Start/End: Complemental strand, 1809590 - 1809526
Alignment:
| Q |
170 |
tttgccttttcagatggatggaatgcatcccaaaatgcattaagttctctgtttgggcacaagtt |
234 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||| | |||||||| ||||||||||| |
|
|
| T |
1809590 |
tttgccttttcagatggatggaatggatcccaaaatacatacaagtctctgttagggcacaagtt |
1809526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 167 - 234
Target Start/End: Original strand, 7385568 - 7385635
Alignment:
| Q |
167 |
ttgtttgccttttcagatggatggaatgcatcccaaaatgcattaagttctctgtttgggcacaagtt |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| | ||||| |||| ||||||||| |
|
|
| T |
7385568 |
ttgtttgccttttcagatggatggaatgcatcccaaaatgcatttaagtctctatttgagcacaagtt |
7385635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 158 - 296
Target Start/End: Original strand, 35376267 - 35376405
Alignment:
| Q |
158 |
actatgattttgtttgccttttcagatggatggaatgcatcccaaaatgcattaagttctctgtttgggcacaagtttgaggctggtgtacaaagcccaa |
257 |
Q |
| |
|
||||||||| || | || ||||||||||||||||||| |||||||||||||| ||| |||| ||| ||||||||||||| ||||| || || |||| |
|
|
| T |
35376267 |
actatgattctgctagctttttcagatggatggaatggatcccaaaatgcataaaggtctcgattttggcacaagtttgaaaggggtgtgcatagtccaa |
35376366 |
T |
 |
| Q |
258 |
gtccattgtatggcccttgtccacagcatgctacctttg |
296 |
Q |
| |
|
|||||||| || ||||||||||| || |||| ||||| |
|
|
| T |
35376367 |
tcccattgtaagggccttgtccacaacaagctatctttg |
35376405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 157 - 237
Target Start/End: Original strand, 35357711 - 35357791
Alignment:
| Q |
157 |
gactatgattttgtttgccttttcagatggatggaatgcatcccaaaatgcattaagttctctgtttgggcacaagtttga |
237 |
Q |
| |
|
|||||||||| || | || |||||||||||||| ||||||||||||||||||| ||| | || ||||||||||| ||||| |
|
|
| T |
35357711 |
gactatgattctgctagctttttcagatggatgaaatgcatcccaaaatgcataaaggtttcgatttgggcacaattttga |
35357791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 176 - 236
Target Start/End: Original strand, 35364521 - 35364581
Alignment:
| Q |
176 |
ttttcagatggatggaatgcatcccaaaatgcattaagttctctgtttgggcacaagtttg |
236 |
Q |
| |
|
|||||||||||||||| || |||||||||||||| || |||| ||| |||||||||||| |
|
|
| T |
35364521 |
ttttcagatggatggattgaatcccaaaatgcatagaggtctcgattttggcacaagtttg |
35364581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 197 - 289
Target Start/End: Original strand, 6339168 - 6339260
Alignment:
| Q |
197 |
tcccaaaatgcattaagttctctgtttgggcacaagtttgaggctggtgtacaaagcccaagtccattgtatggcccttgtccacagcatgct |
289 |
Q |
| |
|
||||||||||||| ||| || || || ||||||||||| || ||||| ||||| || |||| ||||||| |||| ||||| ||||| |||||| |
|
|
| T |
6339168 |
tcccaaaatgcataaagatccctattagggcacaagttagaagctggagtacatagtccaactccattgaatggtccttgaccacaacatgct |
6339260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University