View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2373_high_8 (Length: 254)

Name: NF2373_high_8
Description: NF2373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2373_high_8
NF2373_high_8
[»] chr4 (2 HSPs)
chr4 (147-231)||(39447085-39447169)
chr4 (15-53)||(39446953-39446991)


Alignment Details
Target: chr4 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 147 - 231
Target Start/End: Original strand, 39447085 - 39447169
Alignment:
147 gataaaccaaacaaggcctttcaaattttcacttcaagagaaaaattaagtcacaattcagtcaaagcaagtagaattgaaaatt 231  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39447085 gataaaccaaacaaggcctttcaaattttcacttcaagagaaaaattaagtcacaattcagtcaaagcaagtagaattgaaaatt 39447169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 15 - 53
Target Start/End: Original strand, 39446953 - 39446991
Alignment:
15 atgaattaaacaacgccatagtgttcaatcacacattat 53  Q
    |||||||||||||||||||||||||||||||||||||||    
39446953 atgaattaaacaacgccatagtgttcaatcacacattat 39446991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University