View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2373_low_11 (Length: 254)
Name: NF2373_low_11
Description: NF2373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2373_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 147 - 231
Target Start/End: Original strand, 39447085 - 39447169
Alignment:
| Q |
147 |
gataaaccaaacaaggcctttcaaattttcacttcaagagaaaaattaagtcacaattcagtcaaagcaagtagaattgaaaatt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39447085 |
gataaaccaaacaaggcctttcaaattttcacttcaagagaaaaattaagtcacaattcagtcaaagcaagtagaattgaaaatt |
39447169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 15 - 53
Target Start/End: Original strand, 39446953 - 39446991
Alignment:
| Q |
15 |
atgaattaaacaacgccatagtgttcaatcacacattat |
53 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39446953 |
atgaattaaacaacgccatagtgttcaatcacacattat |
39446991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University