View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2373_low_2 (Length: 444)
Name: NF2373_low_2
Description: NF2373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2373_low_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 117; Significance: 2e-59; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 18 - 236
Target Start/End: Complemental strand, 44246238 - 44246021
Alignment:
| Q |
18 |
taagtttggttgtatgg-tgtttaaatggttgagttgtctgtgtcttgaaaagttaatgttggtatcggaactcaaacctctaacacaatggcatattta |
116 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||||| ||||||||||||| ||||||||| |||||||||||| |||||||| |||||||| |
|
|
| T |
44246238 |
taagtttggttatatgggtgtttaaatggttgagttgtctgt--cttgaaaagttaaagttggtatcagaactcaaacctacaacacaattacatattta |
44246141 |
T |
 |
| Q |
117 |
cacaacaacactgatggtaagatattatcgtgcaaagctgcttctcaaaaatattctttatagattcagtgcattcaccttacagatgtgcatgatttat |
216 |
Q |
| |
|
||||||| ||| ||||||| || ||| ||||| ||||||||||||| || | ||| |||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44246140 |
cacaacagcaccaatggtaaattactattgtgcacagctgcttctcaacaaaaatctgtataaattcagtgcattcaccttacagatgtgcatgatttat |
44246041 |
T |
 |
| Q |
217 |
gacctacaacttaatgtgat |
236 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
44246040 |
aacctacaacttaatgtgat |
44246021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 233 - 278
Target Start/End: Complemental strand, 44246048 - 44246003
Alignment:
| Q |
233 |
tgatttataacctacaacttaatgtgatttgtgtatatggtgtatc |
278 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
44246048 |
tgatttataacctacaacttaatgtgatctgtgtatatggtgtatc |
44246003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 288 - 358
Target Start/End: Complemental strand, 44245662 - 44245590
Alignment:
| Q |
288 |
agtatagaagtgattcagaa--tagatgtttttcatggaatatatgagcgcactctcttttgtagctaaagtt |
358 |
Q |
| |
|
|||||||| ||||||| ||| ||||| ||| |||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
44245662 |
agtatagaggtgattcggaacttagatatttgtcatggaacatatgagtgcactctcttttgtagctaaagtt |
44245590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University