View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2373_low_3 (Length: 435)
Name: NF2373_low_3
Description: NF2373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2373_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 141; Significance: 9e-74; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 141; E-Value: 9e-74
Query Start/End: Original strand, 17 - 173
Target Start/End: Original strand, 991055 - 991211
Alignment:
| Q |
17 |
accaagtaaccttccaatgatccttttgcacttggagatccatcagccacaatccttgcacctttctctattctccccgcctttggagccggtgaaatcg |
116 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
991055 |
accaagtaaccttccaatgatcctttcgcacttggagatccatcagccacaatccttgcaactttctctattctccccgccttcggagccggagaaatcg |
991154 |
T |
|
| Q |
117 |
ctttccttttcttagtagtataaaactgttacacataacaaaatcaacaatgcaagt |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
991155 |
ctttccttttcttagtagtataaaactgttacacataacaaaatcaacaatgcaagt |
991211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 234 - 365
Target Start/End: Original strand, 991272 - 991403
Alignment:
| Q |
234 |
cagcgacattggagaattgaatacttcaataatcgttaccctataatgcgaaattctagggtttgggggaagtggaaatggggatagagaaggacctgat |
333 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
991272 |
cagcgacattggagaattgaatacttcaataatcgttaccctagaatgcgaaattctagggtttgggggaagtggaaatggggatagagaaggacctgat |
991371 |
T |
|
| Q |
334 |
tgaggcgattacgaggggaaggagaggacatg |
365 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |
|
|
| T |
991372 |
tgaggcgattgcgaggggaaggagaggacatg |
991403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University