View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2374_high_15 (Length: 208)
Name: NF2374_high_15
Description: NF2374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2374_high_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 1 - 126
Target Start/End: Original strand, 34578273 - 34578398
Alignment:
| Q |
1 |
gccttacctcaaaatattaacattttttgctgacatgccagtttcaggaaacatggccttccttctatttacatcttcgtgaaatgacttgcctgcactt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34578273 |
gccttacctcaaaatattaacattttttgctgacatgccagtttcaggaaacatggccttccttctatttacatcttcgtgaaatgacttgcctgcactt |
34578372 |
T |
 |
| Q |
101 |
ggtgtaacatctaaaacaatgccctc |
126 |
Q |
| |
|
|||||||||||||||||||| ||||| |
|
|
| T |
34578373 |
ggtgtaacatctaaaacaattccctc |
34578398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University