View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2374_low_16 (Length: 386)
Name: NF2374_low_16
Description: NF2374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2374_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 321; Significance: 0; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 35 - 379
Target Start/End: Original strand, 39396369 - 39396713
Alignment:
| Q |
35 |
ggcatggagtacttatcaatcttctttgagagtttcttacacaacaatgcagcagctattgaacttaatagaatgtgcaaagtatatgtatttgacaaga |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39396369 |
ggcatggagtacttatcaatcttctttgagagtttcttacacaaaaatgcagcagctattgaacttaatagaatgtgcaaagtatatgtatttgacaaga |
39396468 |
T |
|
| Q |
135 |
aagagggaggacttggatgctgcgagtgccgtattttggacaaatcttgattcagtaaagttattgaacatgtttcatttgatattgatccttgacacaa |
234 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39396469 |
aagagggaggacttggatgttgcaagtgccgtattttggacacatcttgattcagtgaagttattgaacatgtttcatttgatattgatccttgacacaa |
39396568 |
T |
|
| Q |
235 |
aacaaataggtacaaacaaccattgcttaaaattgttgatgtaacatctacaaagttatctttttcggcagcttttgcttatttggaacatgaacaacaa |
334 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39396569 |
aacaaataggtacaaacaaccattgcttaaaattgttgatgtaacatctacaaagttatctttttcggcagcttttgcttatttggaacatgaacaacaa |
39396668 |
T |
|
| Q |
335 |
gataattttatttgggcattccaaaatgttagatagttcatctca |
379 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39396669 |
gataattttatttgggcattccaaaatgttagatagttcacctca |
39396713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 253 - 327
Target Start/End: Original strand, 43598128 - 43598202
Alignment:
| Q |
253 |
accattgcttaaaattgttgatgtaacatctacaaagttatctttttcggcagcttttgcttatttggaacatga |
327 |
Q |
| |
|
|||||||||| |||||||| |||||||||| |||||| | |||| || |||||||||||||||||||||||| |
|
|
| T |
43598128 |
accattgctttaaattgttagcgtaacatctatgaagttaacgtttttggtagcttttgcttatttggaacatga |
43598202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 47 - 106
Target Start/End: Original strand, 43597914 - 43597970
Alignment:
| Q |
47 |
ttatcaatcttctttgagagtttcttacacaacaatgcagcagctattgaacttaataga |
106 |
Q |
| |
|
||||| |||||||||||||| ||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
43597914 |
ttatcgatcttctttgagaggttcttacacaaaaat---gcagctattgaacttaataga |
43597970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University