View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2374_low_20 (Length: 364)
Name: NF2374_low_20
Description: NF2374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2374_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 110 - 354
Target Start/End: Original strand, 7235593 - 7235834
Alignment:
| Q |
110 |
cataagaacaagagaaccagttgagccatagaaacgcaacaccagaaaaggctatgtatcctgtctaataaatatgccacaactactatttaaaatcttt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7235593 |
cataagaacaagagaaccagttgagccatagaaacgcaacaccagaaaaggctatgtatcctgtctaata----tgccacaactactatttaaaatcttt |
7235688 |
T |
|
| Q |
210 |
tgttgaaaattacactatattgttaaaataatatccacaccgccttatatgccacaactactacttgaaa-ttttttgttgaaaatcatactaaactgtt |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
7235689 |
tgttgaaaattacactatattgttaaaataatatccacaccgccttatatgccacaactactatttgaaatttttttgttgaaaatcatactaaactgtt |
7235788 |
T |
|
| Q |
309 |
aaaattttctgcacttctattgtttctttctgagagatgccctttg |
354 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
7235789 |
aaaattttctgcacttcgagtgtttctttctgagagatgccctttg |
7235834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University