View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2374_low_28 (Length: 326)
Name: NF2374_low_28
Description: NF2374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2374_low_28 |
 | |
|
| [»] scaffold0047 (2 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 148; Significance: 4e-78; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 105 - 296
Target Start/End: Complemental strand, 30169333 - 30169152
Alignment:
| Q |
105 |
tgcttaatggtcctaatggtggcattgaggtaaaatgagattcttaactttcccatgaaatctttcactttcagtggctcagatggaatccgagagatgg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30169333 |
tgcttaatggtcctaatggtggcattgaggtaaaatgagattcttaactttcccatgaaatctttcactttcag--------atggaatccgagagatgg |
30169242 |
T |
|
| Q |
205 |
tggtagtgtgacctgcggtgatttcacccctgatggtactaatttctctcttcatattttcttgatgcatcttcctttatctattattatct |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30169241 |
tggtagtgtgacctgcggtgatttcacccctcatggtactaattt--ctcttcatattttcttgatgcatcttcctttatctattattatct |
30169152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0047 (Bit Score: 35; Significance: 0.0000000001; HSPs: 2)
Name: scaffold0047
Description:
Target: scaffold0047; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 201 - 288
Target Start/End: Complemental strand, 56114 - 56028
Alignment:
| Q |
201 |
atggtggtagtgtgacctgcggtgatttcacccctgatggtactaatttctctcttcatattttct---tgatgcatcttcctttatctat |
288 |
Q |
| |
|
|||||| ||||||||||| |||||||||| |||||||||||||||| || ||||||||||||| || ||||||||||||||||||| |
|
|
| T |
56114 |
atggtgttagtgtgacctctggtgatttca-ccctgatggtactaat---tcccttcatattttcttcgtgttgcatcttcctttatctat |
56028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0047; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 111 - 155
Target Start/End: Complemental strand, 56318 - 56274
Alignment:
| Q |
111 |
atggtcctaatggtggcattgaggtaaaatgagattcttaacttt |
155 |
Q |
| |
|
|||||||||| |||| ||| |||||||| |||||||||||||||| |
|
|
| T |
56318 |
atggtcctaaaggtgccatagaggtaaagtgagattcttaacttt |
56274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 157 - 189
Target Start/End: Complemental strand, 27744204 - 27744172
Alignment:
| Q |
157 |
ccatgaaatctttcactttcagtggctcagatg |
189 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
27744204 |
ccatgaactctttcactttcagtggctcagatg |
27744172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University