View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2374_low_30 (Length: 323)
Name: NF2374_low_30
Description: NF2374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2374_low_30 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 13 - 245
Target Start/End: Complemental strand, 39030362 - 39030120
Alignment:
| Q |
13 |
tgtgaacgatagtcggagctgctgatttgtggtagaagattacattgatccaccaaagagggtgatttgcaaacaatgattcaatcattcaagtaactga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||| |
|
|
| T |
39030362 |
tgtgaacgatagtcggagctgctgatttgtggtagaagataacattgatccaccaaagagggtgatttgcaaacaatgactcaatcattcaagtaattga |
39030263 |
T |
|
| Q |
113 |
gagttcatgagaattaa----------aaggttcaaccgaacgagatagtgtatctttatacgaagaatattgtataaataaataaggcatttgttacaa |
202 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39030262 |
gagttcatgagaattaatgagaattaaaaggttcaaccgaacgagatagtgtatctttatacgaagaatattgtataaataaataaggcatttgttacaa |
39030163 |
T |
|
| Q |
203 |
atgtggtgcaaattagtgatcaggatatgaagaatatcacagg |
245 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39030162 |
atttggtgcaaattagtgatcaggatatgaagaatatcacagg |
39030120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University