View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2374_low_34 (Length: 318)

Name: NF2374_low_34
Description: NF2374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2374_low_34
NF2374_low_34
[»] chr1 (1 HSPs)
chr1 (79-318)||(12415225-12415462)


Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 79 - 318
Target Start/End: Complemental strand, 12415462 - 12415225
Alignment:
79 aatatcatgaaaataccataacattctttcagcgaatgccattaagttcacaagaagctatcctaaacaaattgcaagatttttcggaaaagtatatccg 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
12415462 aatatcatgaaaataccataacattctttcagcgaatgccattaagttcacaagaagctatcctaaacaaattgcaagatttttgggaaaagtatatccg 12415363  T
179 atgtgtatatcaccctacaaaacttaataacttgctcaagaattacacttgctcacttctcttggatttgggtgcttctaccaccagaccattannnnnn 278  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||            
12415362 atgtgtatatcaccctacaaaacttaataacttgctcaagaattacactcgctcacttctcttggatttgggtgcttctaccaccagaccat--attttt 12415265  T
279 nnnatcaatgtcttcactagaccaaacagtggataaccaa 318  Q
       |||||||||||||||||||||||||||||||||||||    
12415264 tttatcaatgtcttcactagaccaaacagtggataaccaa 12415225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University