View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2374_low_37 (Length: 315)
Name: NF2374_low_37
Description: NF2374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2374_low_37 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 93 - 315
Target Start/End: Original strand, 36980178 - 36980400
Alignment:
| Q |
93 |
attattgtcccacatgtgccaagtgcaatgcaactaccttcacttatttaaatcatgcatgaaaacttttgcttaaaatgattgattagtatctttcatc |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36980178 |
attattgtcccacatgtgccaagtgcaatgcaactaccttcacttatttaaatcatgcatgaaaacttttgcttaaaatgattgattagtatctttcatc |
36980277 |
T |
 |
| Q |
193 |
cataacactattattgcctttacagagttagggaccttaccgtagagtggacacaggttaaacacattattcccagcaccctcgatctacgtgaaggaaa |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
36980278 |
cataacactattattgcctttacagagttagggaccttaccgtagagtggacacagattaaacaaattattcccagcaccctcgatctacgtgaaggaaa |
36980377 |
T |
 |
| Q |
293 |
aacaaaattgatttattagtgct |
315 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
36980378 |
aacaaaattgatttattagtgct |
36980400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University