View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2374_low_41 (Length: 305)

Name: NF2374_low_41
Description: NF2374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2374_low_41
NF2374_low_41
[»] chr2 (1 HSPs)
chr2 (103-195)||(37167921-37168013)


Alignment Details
Target: chr2 (Bit Score: 77; Significance: 9e-36; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 103 - 195
Target Start/End: Complemental strand, 37168013 - 37167921
Alignment:
103 attctcttcattgattcctctctctattacaatctcccattcttttcattgattcctctctcaattatgatcgattgatatgactattgtttc 195  Q
    |||||||||||||||||||||||||||||| |||| ||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||    
37168013 attctcttcattgattcctctctctattacgatcttccattctcttcattgattcctctctctattatgatcgattgatatgactattgtttc 37167921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University