View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2374_low_53 (Length: 260)
Name: NF2374_low_53
Description: NF2374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2374_low_53 |
 |  |
|
| [»] scaffold0240 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 32 - 233
Target Start/End: Original strand, 33052862 - 33053063
Alignment:
| Q |
32 |
gcatggtacaattaacgtttggggtagaaaagtaaagagtctactttgccaggaactaacatatgcttcattttgtaccattaacaacatccaattagat |
131 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| ||||| |||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33052862 |
gcatggtacaattaacgtttggattagaaaagtaaagagtctaccttgcctcgaactaacatctgcttcattttgtaccattaacaacatccaattagat |
33052961 |
T |
 |
| Q |
132 |
gcagaaaatcatattatttatggtgctgggaggcatgggattgtctatgtgtgggatattcgcggtggaagagcatctactatattccttcaatggcata |
231 |
Q |
| |
|
||||||||| | ||||||||||||||| ||||||||||||| || ||||||||||||||||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
33052962 |
gcagaaaataagattatttatggtgctaggaggcatgggatcgtgtatgtgtgggatattcgcggtggaagagcatctactacattccttcaagggcata |
33053061 |
T |
 |
| Q |
232 |
aa |
233 |
Q |
| |
|
|| |
|
|
| T |
33053062 |
aa |
33053063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 57; Significance: 7e-24; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 144 - 212
Target Start/End: Original strand, 24866481 - 24866549
Alignment:
| Q |
144 |
attatttatggtgctgggaggcatgggattgtctatgtgtgggatattcgcggtggaagagcatctact |
212 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
24866481 |
attatttatggtgctgggaggcatgggatcgtgtatgtgtgggatattcgtggtggaagagcatctact |
24866549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 32 - 139
Target Start/End: Original strand, 24865861 - 24865968
Alignment:
| Q |
32 |
gcatggtacaattaacgtttggggtagaaaagtaaagagtctactttgccaggaactaacatatgcttcattttgtaccattaacaacatccaattagat |
131 |
Q |
| |
|
||||||||| ||||| ||||||| ||||| ||||||||| || | ||||| |||||||||| |||||||||| ||||| |||||| | ||||||||||| |
|
|
| T |
24865861 |
gcatggtacgattaatgtttgggatagaagagtaaagagcctgccttgcctcgaactaacatctgcttcatttggtacccttaacagcgtccaattagat |
24865960 |
T |
 |
| Q |
132 |
gcagaaaa |
139 |
Q |
| |
|
|||||||| |
|
|
| T |
24865961 |
gcagaaaa |
24865968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0240 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: scaffold0240
Description:
Target: scaffold0240; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 178 - 231
Target Start/End: Original strand, 15590 - 15643
Alignment:
| Q |
178 |
atgtgtgggatattcgcggtggaagagcatctactatattccttcaatggcata |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
15590 |
atgtgtgggatattcgcggtggaagagcatctattacattccttcaatggcata |
15643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University