View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2374_low_57 (Length: 242)
Name: NF2374_low_57
Description: NF2374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2374_low_57 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 125
Target Start/End: Original strand, 32267728 - 32267852
Alignment:
| Q |
1 |
aattcagagttcaacattatttgttgcatgcacaatgataacaacgtgcatagcatgatcggtttgttagaggtttgtaacccaacacaaaaaagccctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32267728 |
aattcagagttcaacattatttgttgcatgcacaatgataacaacgtgcatagcatgatcggtttgttagaggtttgtaacccaacacaaaaaagccctt |
32267827 |
T |
|
| Q |
101 |
tatgcgtccatgtcattcatctcac |
125 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
32267828 |
tatgcgtccatgtcattcatctcac |
32267852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 206 - 242
Target Start/End: Complemental strand, 32267785 - 32267749
Alignment:
| Q |
206 |
tcatgctatgcactttgttatcattgtgcatgcaaca |
242 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32267785 |
tcatgctatgcacgttgttatcattgtgcatgcaaca |
32267749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University