View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2374_low_63 (Length: 235)

Name: NF2374_low_63
Description: NF2374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2374_low_63
NF2374_low_63
[»] chr5 (1 HSPs)
chr5 (15-111)||(4292415-4292511)


Alignment Details
Target: chr5 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 15 - 111
Target Start/End: Complemental strand, 4292511 - 4292415
Alignment:
15 tgtttgatcgaccaggacatcaagtttatttaaaatcaaaccaaaccgattcgcaaacatctctaattattttcgatcccactactcaagttgattc 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
4292511 tgtttgatcgaccaggacatcaagtttatttaaaatcaaaccaaaccgattcgcaaacatccctaattattttcgatcccactactcaagttgattc 4292415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University