View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2374_low_63 (Length: 235)
Name: NF2374_low_63
Description: NF2374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2374_low_63 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 15 - 111
Target Start/End: Complemental strand, 4292511 - 4292415
Alignment:
| Q |
15 |
tgtttgatcgaccaggacatcaagtttatttaaaatcaaaccaaaccgattcgcaaacatctctaattattttcgatcccactactcaagttgattc |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
4292511 |
tgtttgatcgaccaggacatcaagtttatttaaaatcaaaccaaaccgattcgcaaacatccctaattattttcgatcccactactcaagttgattc |
4292415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University