View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2374_low_67 (Length: 221)
Name: NF2374_low_67
Description: NF2374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2374_low_67 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 69 - 124
Target Start/End: Complemental strand, 8362140 - 8362086
Alignment:
| Q |
69 |
ataaattatccatatactatattttcttatctactaaaatatatttggttttatat |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8362140 |
ataaattatccatatactatattttcttatctac-aaaatatatttggttttatat |
8362086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 81 - 116
Target Start/End: Complemental strand, 8371312 - 8371277
Alignment:
| Q |
81 |
tatactatattttcttatctactaaaatatatttgg |
116 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8371312 |
tatactatattttattatctactaaaatatatttgg |
8371277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University