View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2375_high_17 (Length: 354)
Name: NF2375_high_17
Description: NF2375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2375_high_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 244; Significance: 1e-135; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 252
Target Start/End: Original strand, 50670447 - 50670698
Alignment:
| Q |
1 |
tttacaaaaaggggactgcaaggtgcctctttggatgccaagagaatagctgatgacattgaactgtgtttagaagctgaagcaaagcatggatcataaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
50670447 |
tttacaaaaaggggactgcaaggtgcctctttggatgccaagagaatagctgatgacattgaactgtgtttagaatctgaagcaaagtatggatcataaa |
50670546 |
T |
 |
| Q |
101 |
taattatataaagagcaatttttaattgctccctcaattttgccacataaaattgataattttggccaggtgatagacacaaaagaaaagggattgatca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50670547 |
taattatataaagagcaatttttaattgctccctcaattttgccacataaaattgataattttggccaggtgatagacacaaaagaaaagggattgatca |
50670646 |
T |
 |
| Q |
201 |
ttgaaaacaaatgatcattatcattgatatttgatcttggctgagtaacaga |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50670647 |
ttgaaaacaaatgatcattatcattgatatttgatcttggctgagtaacaga |
50670698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 285 - 342
Target Start/End: Original strand, 50670731 - 50670788
Alignment:
| Q |
285 |
gaggaatatattgaattgaggtaggtttggtatataaatgaatggaaaatgagatatt |
342 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50670731 |
gaggaatatattgaattgaggtaggtttggtatataaatgaatggaaaatgagatatt |
50670788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University