View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2375_low_11 (Length: 431)
Name: NF2375_low_11
Description: NF2375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2375_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 173 - 423
Target Start/End: Complemental strand, 13013522 - 13013272
Alignment:
| Q |
173 |
aaatatgacttttggaaagtgtcaaaaatctacttttatattgttttatctatgatattgaaaactaatttaatggtttgtcaacagatagatctggttc |
272 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
13013522 |
aaatatgacttttggaaagagtcacaaatctacttttatattgttttatctatgatattgaaaactaatgcaatggtttgtcaacagatagatctggttc |
13013423 |
T |
 |
| Q |
273 |
taaatcatggccaccggacaattattctcacgtactacacaagctctgttttataactacaagcaacttccgatccagcggatgcttgattttgacttcc |
372 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13013422 |
taaatcatggccaccggacaattattctcccgtactacacaagctctgttttataactacaagcaacttccgatccagcggatgcttgattttgacttcc |
13013323 |
T |
 |
| Q |
373 |
tttgcggtgtgtatctgctctatcgactttattttcttttgaatgatgatg |
423 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13013322 |
tttgcggtgtgtatctgctctatcgactttattttcttttgaatgaagatg |
13013272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 111; E-Value: 7e-56
Query Start/End: Original strand, 16 - 126
Target Start/End: Complemental strand, 13013685 - 13013575
Alignment:
| Q |
16 |
ctattgttatcgatcatgaacttttaatattatgaatttctttttgtacttgcttaaattagttgatcaatgttctctatatgtgatttgtggtttctac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13013685 |
ctattgttatcgatcatgaacttttaatattatgaatttctttttgtacttgcttaaattagttgatcaatgttctctatatgtgatttgtggtttctac |
13013586 |
T |
 |
| Q |
116 |
taaaatggata |
126 |
Q |
| |
|
||||||||||| |
|
|
| T |
13013585 |
taaaatggata |
13013575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University