View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2375_low_14 (Length: 377)
Name: NF2375_low_14
Description: NF2375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2375_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 288; Significance: 1e-161; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 1 - 363
Target Start/End: Original strand, 39945066 - 39945437
Alignment:
| Q |
1 |
tctttgcatcactatgtgtgcttttggttctcgtaagcagatttcctcttcataataagtttatagtgtgggtattggcgattttgaggatagtcgcaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||| |||||| |||||| ||||| |
|
|
| T |
39945066 |
tctttgcatcactatgtgtgcttttggttctcgtaagcggatttcctcttcataataagtttatagtgtgggttttggcggttttgatgatagttgcaat |
39945165 |
T |
 |
| Q |
101 |
cacatgtatgttgcttacatacatgtgggcgttgggattagttagtcctaatcacattttctatagaattcgtgatttaggttttatcttggttggaatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39945166 |
cacatgtatgttgcttacatacatgtgggcgttgggattagttagtcctaatcacattttctatagaattcgtgatttaggttttatcttggttggaatt |
39945265 |
T |
 |
| Q |
201 |
tggtctttcttactttttgttgtttgtttgattcaaatagctagaattgtgttttgggttaggtctagatgc------------aggtcctcgtcctcca |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | || |||||||||||||||| |
|
|
| T |
39945266 |
tggtctttcttactttttgttgtttgtttgattcaaatagctagaattgtgttttgggttaggtctaaacgcaggtcctcgtcgaggtcctcgtcctcca |
39945365 |
T |
 |
| Q |
289 |
cagatgttgttgcgctatgaaatatttctactatagtttaataataatgcagagatggtgttgatccattttctg |
363 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39945366 |
caga---tgttgcgctttgaaatatttctactatagtttaataataatgcagagatggtgttgatccattttctg |
39945437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 108 - 172
Target Start/End: Original strand, 39954240 - 39954304
Alignment:
| Q |
108 |
atgttgcttacatacatgtgggcgttgggattagttagtcctaatcacattttctatagaattcg |
172 |
Q |
| |
|
|||||||| |||||||||||||| | ||||| ||||||||||||| ||| |||||||||||| |
|
|
| T |
39954240 |
atgttgctcacatacatgtgggcacttggattgattagtcctaatcatgtttgctatagaattcg |
39954304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University