View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2375_low_19 (Length: 353)
Name: NF2375_low_19
Description: NF2375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2375_low_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 136; Significance: 7e-71; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 136; E-Value: 7e-71
Query Start/End: Original strand, 203 - 342
Target Start/End: Original strand, 32982277 - 32982416
Alignment:
| Q |
203 |
gcataggagatatgggatgggattaccctcttattaattcctatatgtattaattataactgaatcttatcacagccatctccaagttgccctgataaat |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32982277 |
gcataggagatatgggatgggattaccctcttattaattcctatatgtattaattataactgaatcttatcacagccatctccaagttgccctgataaat |
32982376 |
T |
 |
| Q |
303 |
cttcactacttctatactccgcagtgtccacaacattcat |
342 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32982377 |
cttcactacttctatactccacagtgtccacaacattcat |
32982416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 18 - 118
Target Start/End: Original strand, 32982140 - 32982240
Alignment:
| Q |
18 |
gttttagtgttaaattttcttctgccacgtaatttctcaagataattcaattggctctctatctccaaacaaacaaagacaagaaaaagcatatccaaca |
117 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32982140 |
gttttagtgttaaattttcttctaccacgtaatttctcaagataattcaattggctctctatctccaaacaaacaaagacaagaaaaagcatatccaaca |
32982239 |
T |
 |
| Q |
118 |
a |
118 |
Q |
| |
|
| |
|
|
| T |
32982240 |
a |
32982240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University