View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2375_low_20 (Length: 351)
Name: NF2375_low_20
Description: NF2375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2375_low_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 79 - 331
Target Start/End: Complemental strand, 4203378 - 4203126
Alignment:
| Q |
79 |
ctctttaccttcatcagcttccttaagtgttggttttggcatttttccacttctcactgctacaccttgcatgccacaacaacaatctcaaaacaatgaa |
178 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4203378 |
ctctttaccttcatcagcttcattaagtgttggttttggcatttttccacttctcactgctacaccttgcatgccacaacaacaatctcaaaacaatgaa |
4203279 |
T |
|
| Q |
179 |
gttcaagaaaatcctagtaacaataacaatttttggaaccttaggatgtgtcctgaagtagtgaatcttccnnnnnnnggagtgatcaatgaagaagaga |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
4203278 |
gttcaagaaaatcctagtaacaataacaatttttggaatcttaggatgtgtcctgaagtagtgaatcttccaaaaaaaggagtgatcactgaagaagaga |
4203179 |
T |
|
| Q |
279 |
atcatggaaaaattgctatgatggagagtgaagaaaatggtgtgtatggttct |
331 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4203178 |
atcatggaaaaattgctatgatggagagtgaagaaaatggtgtgtatggttct |
4203126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University