View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2375_low_21 (Length: 341)
Name: NF2375_low_21
Description: NF2375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2375_low_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 1 - 327
Target Start/End: Original strand, 52676866 - 52677192
Alignment:
| Q |
1 |
agagaaagaagttggtgatttgagaaggaacttattcccaacgccnnnnnnnnnnnnngttggaagcacttttgaaggtgcacctagagagcaacaagct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52676866 |
agagaaagaagttggtgatttgagaaggaacttattcccaacgcctttttcgttttttgttggaagcacttttgaaggtgcacctagagagcaacaagct |
52676965 |
T |
 |
| Q |
101 |
ttgctggaattggaagatactggtgcaagattgatgagggaaaaggaaactttgaaaaacacgcttaattatctatctgctgcttctgccgttaaagatg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52676966 |
ttgctggaattggaagatactggtgcaagattgatgagggaaaaggaaactttgaaaaatacgcttaattatctatctgctgcttctgccgttaaagatg |
52677065 |
T |
 |
| Q |
201 |
tttttccatcttcatcttctccttcctcaccatcatcatgatcaattcaatagagatgcaaagagtttagttcaaatacatgaaaggtattgtttgcatc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52677066 |
tttttccatcttcatcttctccttcctcaccatcatcatgatcaattcaatagagatgcaaagagtttagttcaaatacatgaaaggtattgtttgcatc |
52677165 |
T |
 |
| Q |
301 |
gataatagggaaaaacttgtaaattct |
327 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
52677166 |
gataatagggaaaaacttgtaaattct |
52677192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University