View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2375_low_29 (Length: 285)
Name: NF2375_low_29
Description: NF2375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2375_low_29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 19 - 268
Target Start/End: Original strand, 29063175 - 29063424
Alignment:
| Q |
19 |
agaatcatgcagagttagcagtgatgtgagtccagatgagtactcatttgaaatgaatggttttgttgtaagggatttaccaaagaataaatcttggcct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29063175 |
agaatcatgcagagttagcagtgatgtgagtccagatgagtactcatttgaaatgaatggttttgttgtaagggatttaccaaagaataaatcttggcct |
29063274 |
T |
|
| Q |
119 |
aagaaactgaaaatgatgaatcagttattgtttggtcagaaactcaaagcttcaaaagcttatcttaaatctttgttcaacaaaactagttgttcagaga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29063275 |
aagaaactgaaaatgatgaatcagttattgtttggtcagaaactcaaagcttcaaaagcttatcttaaatctttgttcaacaaaactagttgttcagaga |
29063374 |
T |
|
| Q |
219 |
aagcatgtgctagtgatcctaacaacaaggttggaattaaaaccaaaaac |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
29063375 |
aagcatgtgctagtgatcctaacaacaaggttggaattaaaagcaaaaac |
29063424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University