View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2376_high_12 (Length: 226)
Name: NF2376_high_12
Description: NF2376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2376_high_12 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 28 - 226
Target Start/End: Complemental strand, 41095986 - 41095789
Alignment:
| Q |
28 |
ttgtactttgataaggaattccaaagtaaaataacaacaaaaagatttgcactaaaacctacaaaactaggacaatagtttagactgatgctctcaacag |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41095986 |
ttgtactttgataaggaattccaaagtaaaataacaacaaaaagatttgcactaaaacctacaaaactaggacaatagtttagactgatgctctcaaca- |
41095888 |
T |
|
| Q |
128 |
ggggtgctgcaaagtccaaagtatctttctactatgtccatcacttattcttaatgaatgtaagaatagaaagctcnnnnnnntaggtatatatctaaa |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41095887 |
ggggtgctgcaaagtccaaagtatctttctactatgtccatcacttattcttaatgaatgtaagaatagaaagctcaaaaaaataggtatatatctaaa |
41095789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University