View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2376_high_8 (Length: 239)
Name: NF2376_high_8
Description: NF2376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2376_high_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 118; Significance: 2e-60; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 1 - 122
Target Start/End: Original strand, 1264112 - 1264233
Alignment:
| Q |
1 |
taacacaaaatgagttgatatcactatgggagcttaaaaatggtcaaatccttaacaaagtttttgttccagaagaagatattgtcaagctatcacaaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1264112 |
taacacaaaatgagttgatatcactatgggagcttaaaaatggtcaaatccttaacaaagtttttgctccagaagaagatattgtcaagctatcacaaag |
1264211 |
T |
|
| Q |
101 |
taagactcttttattcaacata |
122 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
1264212 |
taagactcttttattcaacata |
1264233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 4 - 107
Target Start/End: Complemental strand, 1336549 - 1336446
Alignment:
| Q |
4 |
cacaaaatgagttgatatcactatgggagcttaaaaatggtcaaatccttaacaaagtttttgttccagaagaagatattgtcaagctatcacaaagtaa |
103 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||| |||||||| | |||||||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
1336549 |
cacaaaatgagttgatatcactatgggaactcaaaagtggtcaaaactttaacaaagtatttgttccagaagaagatattatcaagctatcacaaagtaa |
1336450 |
T |
|
| Q |
104 |
gact |
107 |
Q |
| |
|
|||| |
|
|
| T |
1336449 |
gact |
1336446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 4 - 103
Target Start/End: Complemental strand, 1320787 - 1320688
Alignment:
| Q |
4 |
cacaaaatgagttgatatcactatgggagcttaaaaatggtcaaatccttaacaaagtttttgttccagaagaagatattgtcaagctatcacaaagtaa |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |||||||| || | ||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
1320787 |
cacaaaatgagttgatatcactatgggagctcaaaagtggtcaaaaatttcataaagtttttgttccagaggaagatattgtcaagctatcacaaagtaa |
1320688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 1253529 - 1253575
Alignment:
| Q |
1 |
taacacaaaatgagttgatatcactatgggagcttaaaaatggtcaa |
47 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1253529 |
taacacaaaatgagttgatataactatgggagcttaaaaatggtcaa |
1253575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 192 - 222
Target Start/End: Original strand, 1264302 - 1264332
Alignment:
| Q |
192 |
catttgtaatgcagttttaccccctccacac |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
1264302 |
catttgtaatgcagttttaccccctccacac |
1264332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University