View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2376_low_11 (Length: 230)
Name: NF2376_low_11
Description: NF2376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2376_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 20 - 218
Target Start/End: Original strand, 52035969 - 52036167
Alignment:
| Q |
20 |
atttaaccgttttctgtgggaacaggggatgcctcaacattaggcaaggcaactactgttgttagtctgtttgagattctatacagcaagtaaacaataa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
52035969 |
atttaaccgttttctgtgggaacaggggatgcctcaacataaggcaaggcaactactgttgttagtctgtttgagattctatacaacaagtaaacaataa |
52036068 |
T |
 |
| Q |
120 |
ttgcgaatgctaattaagttcacaacaacgagcaattgcatttattccatttaataagaatctctattggtgttgcacaaattcactatacacaggttc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52036069 |
ttgcgaatgctaattaagttcacaacaacgaccaattgcatttattccatttaataagaatctctattggtgttgcacaaattcactatacacaggttc |
52036167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University