View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2376_low_13 (Length: 221)
Name: NF2376_low_13
Description: NF2376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2376_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 41095797 - 41095591
Alignment:
| Q |
1 |
atatctaaaagaattgccaagaaaaaagaataacatattgtcctcatcactgagcagctggtggctcagaactagcaacttgctcaccctcaactgctgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41095797 |
atatctaaaagaattgccaagaaaaaagaataacatattgtcctcatcactgagcagctggtggctcagaactagcaacttgctcaccctcaactgctgg |
41095698 |
T |
 |
| Q |
101 |
aggatcttgttgttcaccattagcagaagcagcagcagcagtatcatcttttgtaggtgtagtaggcttattttctgcagaacctggagaggcagtggca |
200 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
41095697 |
aggatcttgttgttcaccattaacagaagcagcagcagcagcatcatcttttgtaggtgtagtaggcttattttctgcagaacctggagaggcagtagca |
41095598 |
T |
 |
| Q |
201 |
gttggtg |
207 |
Q |
| |
|
||||||| |
|
|
| T |
41095597 |
gttggtg |
41095591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University