View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2377_low_2 (Length: 401)
Name: NF2377_low_2
Description: NF2377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2377_low_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-100
Query Start/End: Original strand, 18 - 286
Target Start/End: Complemental strand, 7887802 - 7887537
Alignment:
| Q |
18 |
acaaaaccacatgatcccatgaaaatggagaagataaagcttagtacaaagagggcatgaagaagaagttggaatggaagctccatannnnnnnnnnnnn |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7887802 |
acaaaaccacatgatcccatgaaaatggagaagataaagcttagtacaaagaggacatgaagaagaagttggaatggaagctccatatgttgtgtgtgtt |
7887703 |
T |
|
| Q |
118 |
nnnnnnagtgatcaagacattatataatatgattgcgtgatcaagatattttgcaagttgcatggaccgttgacagtgacctgacactgaccacaatcat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7887702 |
tgtgtgagtgatcaagacattatataatatgattgagtgatcaa---attttgcaagttgcttggaccgttgacagtgacctgacactgaccacaatcat |
7887606 |
T |
|
| Q |
218 |
tggtatatccctatttggaggatacattgattttttctggttacatgaggatgtattgctttatacaca |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7887605 |
tggtatatccctatttggaggatacattgattttttctggttacatgaggatgtattgctttatacaca |
7887537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University