View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2378_high_2 (Length: 331)
Name: NF2378_high_2
Description: NF2378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2378_high_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 17 - 322
Target Start/End: Original strand, 41420144 - 41420449
Alignment:
| Q |
17 |
actctaaaaccagggaatcccatgtcttttgaaagactgtaaactatgtgaacgaggttacggtcacattcaatgtctgtgtcatgttctaatatttcag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41420144 |
actctaaaaccagggaatcccatgtcttttgaaagactgtaaactatgtgaacgaggttacggtcacattcaatgtctgtgtcatgttctaatatttcag |
41420243 |
T |
 |
| Q |
117 |
ctatgcttatgaaacttgggtggctaaaaaccgttgcagcgtaaatttcatcgcttattaagtgaatacgcttttcgttgatgaaatttacaacggttct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41420244 |
ctatgcttatgaaacttgggtggctaaaaaccgttgcagcgtaaatttcatcgcttattaagtgaatacgcttttcgttgatgaaatttacaacggttct |
41420343 |
T |
 |
| Q |
217 |
taatgtgtttctgtccataactgtgcctaatggatttgagggatttgttatgagtaaacctttaattctgatgttatcttctgtggctttttcatatgct |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41420344 |
taatgtgtttctgtccataactgtgcctaatggatttgagggatttgttatgagtaaacctttaattctgatgttatcttctgtggctttttcatatgct |
41420443 |
T |
 |
| Q |
317 |
tcttct |
322 |
Q |
| |
|
|||||| |
|
|
| T |
41420444 |
tcttct |
41420449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University