View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2378_high_5 (Length: 243)
Name: NF2378_high_5
Description: NF2378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2378_high_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 14 - 210
Target Start/End: Original strand, 3952934 - 3953130
Alignment:
| Q |
14 |
atgaaaaccaaagtacgagtgaacctttttagttacaacgttggtttagtttagcgcgttttcgtaccttttttcgattgttctattttggagattggaa |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3952934 |
atgaaaaccaaagtacgagtgaacctttttagttacaacgttggtttagttcagcgcgttttcgtacctttt-tcgattgttctattttggagattggaa |
3953032 |
T |
|
| Q |
114 |
aataaacatagtacatgtgtctgtgtgtttgtgtaagagtttaagtgtaagccaatgcaatcaatgtgcgtggaccaatagttt-gtctggacggtgg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
3953033 |
aataaacatagtacatgtgtctgtgtgtttgtgcaagagtttaagtgtaagccaatgcaatcaatgtgcgtggaccaatagtttggtctggacggtgg |
3953130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University