View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2378_low_10 (Length: 206)
Name: NF2378_low_10
Description: NF2378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2378_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 20 - 108
Target Start/End: Complemental strand, 24555703 - 24555611
Alignment:
| Q |
20 |
ttgtgtacagctattagttggtcattaagagtagcatcaatgagcaacacgtaatata----tgtttgtgagttagtgtttgcttctatgccc |
108 |
Q |
| |
|
|||||||||||||||||||||| || |||||| || ||||||||||||||||||||| ||| |||||||||||||||| |||||||||| |
|
|
| T |
24555703 |
ttgtgtacagctattagttggtaatcaagagttgcttcaatgagcaacacgtaatattgttgtgtatgtgagttagtgtttggttctatgccc |
24555611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 146 - 190
Target Start/End: Complemental strand, 24555051 - 24555007
Alignment:
| Q |
146 |
tagaaggaatatatcattccaccacattaacaccctcatagtata |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
24555051 |
tagaaggaatatatcattccaccacattaacactctcaaagtata |
24555007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University