View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2379_low_2 (Length: 466)
Name: NF2379_low_2
Description: NF2379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2379_low_2 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 346; Significance: 0; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 346; E-Value: 0
Query Start/End: Original strand, 61 - 450
Target Start/End: Complemental strand, 32901583 - 32901203
Alignment:
| Q |
61 |
ctaaagcaaatgcaacaaatgctgaaaaacaccagaaccaccaccgctccaacggcgattccgatgacagttcctgttgatatacttgatgatgacggtg |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32901583 |
ctaaagcaaatgcaacaaatgctgaaaaacaccagaaccaccaccgctccaacggcgattccgatgacagttcctgttgatatacttgatgaagacggtg |
32901484 |
T |
|
| Q |
161 |
gtgaaggtggcggtggagttttggaggatggtggtgatggactgtcatcagagcttggtggagtccgggaaggtggagacggggtagtgcctcctccggt |
260 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
32901483 |
gtgaaggtggcggcggagttttggaggatggtggtgatggactgtcatcagagcttggtggagtccgggaaggtggagacggagtagtgcctcctccg-- |
32901386 |
T |
|
| Q |
261 |
cggtggcgacggtggtgatatcgccggagttgttggtggcgagggtggtgaatttgaaggtgttgatggtggtggtgctgatggagtcgtcgacggaggt |
360 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32901385 |
-------gacggtggtgatatcgccggagttgttggtggcgagggtggtgaatttgaaggtgttgatggtggtggtgctgatggagtcgtcgacggaggt |
32901293 |
T |
|
| Q |
361 |
ggtgatgaaggtgttgccggggtagaaggaggcggagcagatggggtgaccggtggtggattcgccggagttgacggcggaggtgatgaa |
450 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32901292 |
ggtgatgaaggtgttgccggggtagaaggaggcggagcagatggggtgaccggtggtggattcgccggagttgacggcggaggtgatgaa |
32901203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 8 - 41
Target Start/End: Complemental strand, 32901636 - 32901603
Alignment:
| Q |
8 |
gataatactgctgaccatagtattcttcatcacg |
41 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |
|
|
| T |
32901636 |
gataattctgctgaccatagtattcttcatcacg |
32901603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University