View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2381_high_1 (Length: 279)
Name: NF2381_high_1
Description: NF2381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2381_high_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 11 - 264
Target Start/End: Original strand, 5206888 - 5207141
Alignment:
| Q |
11 |
cacagaatctggtttgttgatgctgttattcatttgttgttaannnnnnnatacatctttttcatgtcttctattgatgcttaacaagtgtatttttcca |
110 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5206888 |
cacagaaactggtttgttgatgctgttattcatttgttgttaatttttttatacatctttttcatgtcttctattgatgcttaacaagtgtatttttcca |
5206987 |
T |
 |
| Q |
111 |
tctacatttcatataggatgttgatgcagttgataaaatttgtgaagaaatagaagaggaggaatgcttgatgaggaggacacttgttgctcataccgac |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5206988 |
tctacatttcatataggatgttgatgcagttgataaaatttgtgaagaaatagaagaggaggaatgcttgatgaggaggacacttgttgctcataccgac |
5207087 |
T |
 |
| Q |
211 |
tatatttatacgcagaagcataacccttgaaacaatcttcaccctccttgtttt |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5207088 |
tatatttatacgcagaagcataacccttgaaacaatcttcaccctccttgtttt |
5207141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University