View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2381_high_6 (Length: 275)
Name: NF2381_high_6
Description: NF2381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2381_high_6 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 33 - 221
Target Start/End: Complemental strand, 34367615 - 34367446
Alignment:
| Q |
33 |
accacagaaaatccaacattggaccaacaacttaataattattattattcccatatcgatcactaaactaaaatatgattcgagcaagtggaacgatgaa |
132 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
34367615 |
accaccgaaaatccaacattggaccaacaacttaataattattattattcacatatcgatcactaaactaaaatatgattcgagccagcggaacgatgaa |
34367516 |
T |
|
| Q |
133 |
ccttctttcatcatcggtgttgatcccaccactataatataataaaagatgggtagaataagcttttgatacttataaattcgttttta |
221 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34367515 |
ccttctttcatcatcggtgttg-------------------ataaaagatgggtagaataagcttttgatacttataaattcgttttta |
34367446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University