View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2381_high_7 (Length: 262)
Name: NF2381_high_7
Description: NF2381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2381_high_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 29 - 248
Target Start/End: Complemental strand, 43338243 - 43338024
Alignment:
| Q |
29 |
aaaggcacctaatttggtttacaaaggaaggttacagaatcagaaacgttggattgctgtgaagaagttcgggaaagctgcttggccggatccaaaacag |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43338243 |
aaaggcacctaatttggtttacaaaggaaggttacagaatcagaaacgttggattgctgtgaagaagttcggtaaagctgcttggccggatccaaaacag |
43338144 |
T |
|
| Q |
129 |
tttgttgaagaagcttctggtgttggcaaattgcgtcatcctcgacttgctaatttgattggttattgttgtgatggtgatgagaggttacttgttgctg |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43338143 |
tttgttgaagaagcttctggtgttggcaaattgcgtcatcctcgacttgctaatttgattggttattgttgtgatggtgatgagaggttacttgttgctg |
43338044 |
T |
|
| Q |
229 |
agtttatgcctaatgatacc |
248 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
43338043 |
agtttatgcctaatgatacc |
43338024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University