View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2381_high_9 (Length: 252)
Name: NF2381_high_9
Description: NF2381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2381_high_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 33368938 - 33369183
Alignment:
| Q |
1 |
catgtaggaatgctgaggtcattgatcatgtgaataatgtatgagatgatggtgaccccgtgggtaa--gaaagattatcaaaatgccatatcattgggg |
98 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||| | |
|
|
| T |
33368938 |
catgtaggaatgctgaggtcattaatcatgtgaataatgtatgagatgatggtgacccggtgggtaaaagaaagattatcaaaatgccatatcattggag |
33369037 |
T |
 |
| Q |
99 |
acaactatacactatcttaagtcagttttcactttttatac--atatataaaaaatcaggtgggannnnnnnnnnctctgaatatatttttattttagca |
196 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33369038 |
acaactatacactatctcaagtcagttttcactttttatacatatatataaaaaatcaggtgggattttttttttctctgaatatatttttattttagca |
33369137 |
T |
 |
| Q |
197 |
cgttatgaaattcttatttatatggcgttgctacatccccttcata |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33369138 |
cgttatgaaattcttatttatatggcgttgctacatccccttcata |
33369183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University