View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2381_low_10 (Length: 275)

Name: NF2381_low_10
Description: NF2381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2381_low_10
NF2381_low_10
[»] chr6 (1 HSPs)
chr6 (33-221)||(34367446-34367615)


Alignment Details
Target: chr6 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 33 - 221
Target Start/End: Complemental strand, 34367615 - 34367446
Alignment:
33 accacagaaaatccaacattggaccaacaacttaataattattattattcccatatcgatcactaaactaaaatatgattcgagcaagtggaacgatgaa 132  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| || |||||||||||    
34367615 accaccgaaaatccaacattggaccaacaacttaataattattattattcacatatcgatcactaaactaaaatatgattcgagccagcggaacgatgaa 34367516  T
133 ccttctttcatcatcggtgttgatcccaccactataatataataaaagatgggtagaataagcttttgatacttataaattcgttttta 221  Q
    ||||||||||||||||||||||                   ||||||||||||||||||||||||||||||||||||||||||||||||    
34367515 ccttctttcatcatcggtgttg-------------------ataaaagatgggtagaataagcttttgatacttataaattcgttttta 34367446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University